Mutagenetix > Incidental Mutations

Incidental Mutation 'R1249:Cpxm2'

151701

Institutional Source

Beutler Lab

Gene Symbol

Cpxm2

Ensembl Gene

ENSMUSG00000030862

Gene Name

carboxypeptidase X 2 (M14 family)

Synonyms

4632435C11Rik

MMRRC Submission

039316-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R1249 (G1)

Quality Score

214

Status

Not validated

Chromosome

Chromosomal Location

132032687-132154739 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 132128350 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000033149 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033149] [ENSMUST00000124096]

Predicted Effect

probably null
Transcript: ENSMUST00000033149

SMART Domains

Protein: ENSMUSP00000033149
Gene: ENSMUSG00000030862

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	52	59	N/A	INTRINSIC
low complexity region	72	82	N/A	INTRINSIC
low complexity region	87	98	N/A	INTRINSIC
FA58C	143	301	2.18e-46	SMART
Zn_pept	448	736	9.21e-58	SMART
low complexity region	751	764	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124096

SMART Domains

Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	118	4.8e-19	PFAM
Pfam:Pkinase_Tyr	1	118	1.7e-50	PFAM
low complexity region	146	160	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127039

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136188

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp8b2	A	C	3: 89,947,804	N586K	possibly damaging	Het
Clca3a2	T	C	3: 144,803,004	R685G	possibly damaging	Het
Dsg4	A	T	18: 20,446,872	R45*	probably null	Het
Lama4	A	G	10: 39,075,478	E1073G	probably damaging	Het
Mug1	A	G	6: 121,849,461	I167V	probably benign	Het
Olfr1509	G	A	14: 52,450,522	M36I	probably benign	Het
Prox1	C	T	1: 190,147,061	R640H	possibly damaging	Het
Rad50	T	A	11: 53,692,137	E476D	probably damaging	Het
Sars	A	G	3: 108,435,935	V80A	probably benign	Het
Setd2	T	A	9: 110,573,880	M1863K	probably damaging	Het
Slc13a1	G	T	6: 24,133,650	P201Q	probably benign	Het
Taok1	A	C	11: 77,571,637	W209G	probably damaging	Het
Vmn1r217	T	A	13: 23,114,648	H28L	probably benign	Het

Other mutations in Cpxm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01862:Cpxm2	APN	7	132059811	missense	probably benign	0.01
IGL02039:Cpxm2	APN	7	132047753	missense	probably damaging	1.00
IGL03011:Cpxm2	APN	7	132049078	missense	possibly damaging	0.46
R0033:Cpxm2	UTSW	7	132062157	missense	possibly damaging	0.55
R0100:Cpxm2	UTSW	7	132054871	missense	possibly damaging	0.90
R0100:Cpxm2	UTSW	7	132054871	missense	possibly damaging	0.90
R0453:Cpxm2	UTSW	7	132128405	missense	probably damaging	1.00
R0555:Cpxm2	UTSW	7	132044043	nonsense	probably null
R0655:Cpxm2	UTSW	7	132054820	missense	possibly damaging	0.87
R0834:Cpxm2	UTSW	7	132154613	intron	probably benign
R1145:Cpxm2	UTSW	7	132057648	missense	probably damaging	0.99
R1145:Cpxm2	UTSW	7	132057648	missense	probably damaging	0.99
R1563:Cpxm2	UTSW	7	132143682	missense	probably benign	0.00
R1565:Cpxm2	UTSW	7	132062145	missense	probably damaging	1.00
R1709:Cpxm2	UTSW	7	132059834	missense	probably damaging	1.00
R1863:Cpxm2	UTSW	7	132143663	splice site	probably null
R1874:Cpxm2	UTSW	7	132059834	missense	probably damaging	1.00
R1958:Cpxm2	UTSW	7	132062147	missense	probably damaging	1.00
R2273:Cpxm2	UTSW	7	132059852	intron	probably benign
R3806:Cpxm2	UTSW	7	132080091	missense	probably benign	0.12
R3861:Cpxm2	UTSW	7	132054919	missense	probably benign	0.00
R4570:Cpxm2	UTSW	7	132143706	missense	probably benign	0.11
R4642:Cpxm2	UTSW	7	132070881	missense	probably benign	0.11
R4684:Cpxm2	UTSW	7	132049038	missense	possibly damaging	0.92
R4717:Cpxm2	UTSW	7	132054845	missense	possibly damaging	0.61
R4863:Cpxm2	UTSW	7	132059747	missense	probably benign	0.13
R5079:Cpxm2	UTSW	7	132154285	critical splice donor site	probably null
R5341:Cpxm2	UTSW	7	132154613	intron	probably benign
R5626:Cpxm2	UTSW	7	132059852	intron	probably benign
R5666:Cpxm2	UTSW	7	132054896	missense	probably benign	0.44
R5815:Cpxm2	UTSW	7	132044110	missense	probably damaging	1.00
R6114:Cpxm2	UTSW	7	132154306	missense	probably benign
R6133:Cpxm2	UTSW	7	132128453	missense	probably damaging	1.00
R6224:Cpxm2	UTSW	7	132143731	missense	probably benign
R6468:Cpxm2	UTSW	7	132070860	missense	probably damaging	1.00
R6657:Cpxm2	UTSW	7	132049077	missense	probably damaging	1.00
R7058:Cpxm2	UTSW	7	132143679	missense	probably benign	0.32
R7100:Cpxm2	UTSW	7	132054815	missense	probably benign	0.06
R7198:Cpxm2	UTSW	7	132080084	missense	probably damaging	1.00
R7712:Cpxm2	UTSW	7	132154378	missense	possibly damaging	0.69
RF014:Cpxm2	UTSW	7	132070863	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- CCCGAGAGCCAGTGAGAATCTTTG -3'
(R):5'- ACATGACCACTTCTGAAAGGCAGAC -3'

Sequencing Primer
(F):5'- CCAGTGAGAATCTTTGGAACTGC -3'
(R):5'- CTGAAAGGCAGACATTCATTTCC -3'

Posted On

2014-01-29