Incidental Mutation 'R1249:Cpxm2'
ID151701
Institutional Source Beutler Lab
Gene Symbol Cpxm2
Ensembl Gene ENSMUSG00000030862
Gene Namecarboxypeptidase X 2 (M14 family)
Synonyms4632435C11Rik
MMRRC Submission 039316-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R1249 (G1)
Quality Score214
Status Not validated
Chromosome7
Chromosomal Location132032687-132154739 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 132128350 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033149] [ENSMUST00000124096]
Predicted Effect probably null
Transcript: ENSMUST00000033149
SMART Domains Protein: ENSMUSP00000033149
Gene: ENSMUSG00000030862

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 52 59 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
FA58C 143 301 2.18e-46 SMART
Zn_pept 448 736 9.21e-58 SMART
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136188
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b2 A C 3: 89,947,804 N586K possibly damaging Het
Clca3a2 T C 3: 144,803,004 R685G possibly damaging Het
Dsg4 A T 18: 20,446,872 R45* probably null Het
Lama4 A G 10: 39,075,478 E1073G probably damaging Het
Mug1 A G 6: 121,849,461 I167V probably benign Het
Olfr1509 G A 14: 52,450,522 M36I probably benign Het
Prox1 C T 1: 190,147,061 R640H possibly damaging Het
Rad50 T A 11: 53,692,137 E476D probably damaging Het
Sars A G 3: 108,435,935 V80A probably benign Het
Setd2 T A 9: 110,573,880 M1863K probably damaging Het
Slc13a1 G T 6: 24,133,650 P201Q probably benign Het
Taok1 A C 11: 77,571,637 W209G probably damaging Het
Vmn1r217 T A 13: 23,114,648 H28L probably benign Het
Other mutations in Cpxm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Cpxm2 APN 7 132059811 missense probably benign 0.01
IGL02039:Cpxm2 APN 7 132047753 missense probably damaging 1.00
IGL03011:Cpxm2 APN 7 132049078 missense possibly damaging 0.46
R0033:Cpxm2 UTSW 7 132062157 missense possibly damaging 0.55
R0100:Cpxm2 UTSW 7 132054871 missense possibly damaging 0.90
R0100:Cpxm2 UTSW 7 132054871 missense possibly damaging 0.90
R0453:Cpxm2 UTSW 7 132128405 missense probably damaging 1.00
R0555:Cpxm2 UTSW 7 132044043 nonsense probably null
R0655:Cpxm2 UTSW 7 132054820 missense possibly damaging 0.87
R0834:Cpxm2 UTSW 7 132154613 intron probably benign
R1145:Cpxm2 UTSW 7 132057648 missense probably damaging 0.99
R1145:Cpxm2 UTSW 7 132057648 missense probably damaging 0.99
R1563:Cpxm2 UTSW 7 132143682 missense probably benign 0.00
R1565:Cpxm2 UTSW 7 132062145 missense probably damaging 1.00
R1709:Cpxm2 UTSW 7 132059834 missense probably damaging 1.00
R1863:Cpxm2 UTSW 7 132143663 splice site probably null
R1874:Cpxm2 UTSW 7 132059834 missense probably damaging 1.00
R1958:Cpxm2 UTSW 7 132062147 missense probably damaging 1.00
R2273:Cpxm2 UTSW 7 132059852 intron probably benign
R3806:Cpxm2 UTSW 7 132080091 missense probably benign 0.12
R3861:Cpxm2 UTSW 7 132054919 missense probably benign 0.00
R4570:Cpxm2 UTSW 7 132143706 missense probably benign 0.11
R4642:Cpxm2 UTSW 7 132070881 missense probably benign 0.11
R4684:Cpxm2 UTSW 7 132049038 missense possibly damaging 0.92
R4717:Cpxm2 UTSW 7 132054845 missense possibly damaging 0.61
R4863:Cpxm2 UTSW 7 132059747 missense probably benign 0.13
R5079:Cpxm2 UTSW 7 132154285 critical splice donor site probably null
R5341:Cpxm2 UTSW 7 132154613 intron probably benign
R5626:Cpxm2 UTSW 7 132059852 intron probably benign
R5666:Cpxm2 UTSW 7 132054896 missense probably benign 0.44
R5815:Cpxm2 UTSW 7 132044110 missense probably damaging 1.00
R6114:Cpxm2 UTSW 7 132154306 missense probably benign
R6133:Cpxm2 UTSW 7 132128453 missense probably damaging 1.00
R6224:Cpxm2 UTSW 7 132143731 missense probably benign
R6468:Cpxm2 UTSW 7 132070860 missense probably damaging 1.00
R6657:Cpxm2 UTSW 7 132049077 missense probably damaging 1.00
R7058:Cpxm2 UTSW 7 132143679 missense probably benign 0.32
R7100:Cpxm2 UTSW 7 132054815 missense probably benign 0.06
R7198:Cpxm2 UTSW 7 132080084 missense probably damaging 1.00
R7712:Cpxm2 UTSW 7 132154378 missense possibly damaging 0.69
RF014:Cpxm2 UTSW 7 132070863 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CCCGAGAGCCAGTGAGAATCTTTG -3'
(R):5'- ACATGACCACTTCTGAAAGGCAGAC -3'

Sequencing Primer
(F):5'- CCAGTGAGAATCTTTGGAACTGC -3'
(R):5'- CTGAAAGGCAGACATTCATTTCC -3'
Posted On2014-01-29