Incidental Mutation 'R1250:Gabrr2'
ID151716
Institutional Source Beutler Lab
Gene Symbol Gabrr2
Ensembl Gene ENSMUSG00000023267
Gene Namegamma-aminobutyric acid (GABA) C receptor, subunit rho 2
Synonyms
MMRRC Submission 039317-MU
Accession Numbers

Genbank: NM_008076; MGI: 95626; Ensembl: ENSMUST00000108162, ENSMUST00000147889, ENSMUST00000131920, ENSMUST00000024035

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1250 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location33062999-33095865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33063273 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 32 (L32P)
Ref Sequence ENSEMBL: ENSMUSP00000024035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024035] [ENSMUST00000108162]
Predicted Effect probably benign
Transcript: ENSMUST00000024035
AA Change: L32P

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024035
Gene: ENSMUSG00000023267
AA Change: L32P

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 81 286 3.4e-53 PFAM
Pfam:Neur_chan_memb 293 454 1.9e-32 PFAM
transmembrane domain 472 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108162
AA Change: L7P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103797
Gene: ENSMUSG00000023267
AA Change: L7P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 57 261 9.7e-57 PFAM
Pfam:Neur_chan_memb 268 414 4.2e-36 PFAM
transmembrane domain 447 464 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. The protein encoded by this gene is a member of the rho subunit family and is a component of the GABA type A receptor complex. This gene exists on chromosome 6q next to the gene encoding the rho 1 subunit of the GABA type A receptor, in a region thought to be associated with susceptibility for psychiatric disorders and epilepsy. Polymorphisms in this gene may also be associated with alcohol dependence, and general cognitive ability. [provided by RefSeq, Apr 2016]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,925,975 probably null Het
Aptx T A 4: 40,693,447 E162D probably benign Het
Cdhr4 A T 9: 107,997,516 Q20L probably damaging Het
Dlk1 A T 12: 109,459,818 T206S probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Kntc1 T A 5: 123,784,199 S954T possibly damaging Het
Krt28 A G 11: 99,366,822 probably null Het
Lingo3 T C 10: 80,834,771 T442A probably benign Het
Map3k5 G A 10: 20,110,775 A912T possibly damaging Het
Msantd3 C A 4: 48,552,789 P126Q probably damaging Het
Nek10 T C 14: 14,853,887 S358P probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Qtrt1 C T 9: 21,419,548 T324M probably benign Het
Rag2 A G 2: 101,630,439 S365G probably damaging Het
Slc6a2 C A 8: 92,992,863 T402K probably benign Het
Slc9b1 T C 3: 135,348,770 M1T probably null Het
Ttn A G 2: 76,890,560 probably benign Het
Vmn1r31 A G 6: 58,472,658 V74A probably benign Het
Zkscan3 A G 13: 21,388,524 F313L probably benign Het
Other mutations in Gabrr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Gabrr2 APN 4 33085626 missense probably damaging 1.00
IGL02070:Gabrr2 APN 4 33095340 nonsense probably null
IGL03283:Gabrr2 APN 4 33082364 splice site probably benign
D3080:Gabrr2 UTSW 4 33084466 missense probably damaging 1.00
R1381:Gabrr2 UTSW 4 33081420 missense probably damaging 1.00
R1630:Gabrr2 UTSW 4 33085647 missense probably damaging 1.00
R1782:Gabrr2 UTSW 4 33085593 missense probably damaging 1.00
R1830:Gabrr2 UTSW 4 33077481 missense probably damaging 1.00
R2000:Gabrr2 UTSW 4 33084400 missense probably damaging 1.00
R2125:Gabrr2 UTSW 4 33095548 missense probably damaging 1.00
R2679:Gabrr2 UTSW 4 33071435 missense probably damaging 1.00
R3695:Gabrr2 UTSW 4 33071430 missense probably damaging 1.00
R3891:Gabrr2 UTSW 4 33081348 missense probably damaging 1.00
R3892:Gabrr2 UTSW 4 33081348 missense probably damaging 1.00
R4902:Gabrr2 UTSW 4 33095512 missense probably damaging 1.00
R5328:Gabrr2 UTSW 4 33082565 missense probably damaging 1.00
R5330:Gabrr2 UTSW 4 33082583 missense possibly damaging 0.87
R5331:Gabrr2 UTSW 4 33082583 missense possibly damaging 0.87
R5399:Gabrr2 UTSW 4 33071458 critical splice donor site probably null
R7299:Gabrr2 UTSW 4 33095284 missense probably benign 0.02
R7301:Gabrr2 UTSW 4 33095284 missense probably benign 0.02
R7605:Gabrr2 UTSW 4 33082560 missense probably damaging 1.00
R7697:Gabrr2 UTSW 4 33071358 missense probably benign
R7860:Gabrr2 UTSW 4 33081470 nonsense probably null
R7943:Gabrr2 UTSW 4 33081470 nonsense probably null
X0017:Gabrr2 UTSW 4 33082328 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAATCTCAGCCTTGCCAAC -3'
(R):5'- CGCATCTGAGCCGTCTACCAAAATG -3'

Sequencing Primer
(F):5'- AGCCTTGCCAACCATGC -3'
(R):5'- GCTCTTAATGCACATGAGTGTCAG -3'
Posted On2014-01-29