Incidental Mutation 'R1250:Vmn1r31'
ID 151722
Institutional Source Beutler Lab
Gene Symbol Vmn1r31
Ensembl Gene ENSMUSG00000115404
Gene Name vomeronasal 1 receptor 31
Synonyms Gm6709
MMRRC Submission 039317-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock # R1250 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 58470941-58475330 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58472658 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 74 (V74A)
Ref Sequence ENSEMBL: ENSMUSP00000153749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176023] [ENSMUST00000176147] [ENSMUST00000176177] [ENSMUST00000177318] [ENSMUST00000226390] [ENSMUST00000228586]
AlphaFold H3BKW5
Predicted Effect probably benign
Transcript: ENSMUST00000176023
AA Change: V25A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000135252
Gene: ENSMUSG00000115404
AA Change: V25A

DomainStartEndE-ValueType
Pfam:V1R 1 58 1.9e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176147
AA Change: V25A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000135282
Gene: ENSMUSG00000115404
AA Change: V25A

DomainStartEndE-ValueType
Pfam:V1R 1 58 1.9e-14 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000135472
Gene: ENSMUSG00000093379
AA Change: V74A

DomainStartEndE-ValueType
Pfam:V1R 28 293 4.7e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177318
AA Change: V74A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000135555
Gene: ENSMUSG00000115404
AA Change: V74A

DomainStartEndE-ValueType
Pfam:V1R 28 107 1.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204999
Predicted Effect probably benign
Transcript: ENSMUST00000226390
AA Change: V74A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000228586
AA Change: V74A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,925,975 probably null Het
Aptx T A 4: 40,693,447 E162D probably benign Het
Cdhr4 A T 9: 107,997,516 Q20L probably damaging Het
Dlk1 A T 12: 109,459,818 T206S probably damaging Het
Gabrr2 T C 4: 33,063,273 L32P probably benign Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Kntc1 T A 5: 123,784,199 S954T possibly damaging Het
Krt28 A G 11: 99,366,822 probably null Het
Lingo3 T C 10: 80,834,771 T442A probably benign Het
Map3k5 G A 10: 20,110,775 A912T possibly damaging Het
Msantd3 C A 4: 48,552,789 P126Q probably damaging Het
Nek10 T C 14: 14,853,887 S358P probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Qtrt1 C T 9: 21,419,548 T324M probably benign Het
Rag2 A G 2: 101,630,439 S365G probably damaging Het
Slc6a2 C A 8: 92,992,863 T402K probably benign Het
Slc9b1 T C 3: 135,348,770 M1T probably null Het
Ttn A G 2: 76,890,560 probably benign Het
Zkscan3 A G 13: 21,388,524 F313L probably benign Het
Other mutations in Vmn1r31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Vmn1r31 APN 6 58472799 missense probably benign 0.06
IGL01386:Vmn1r31 APN 6 58472602 missense probably benign 0.22
IGL01785:Vmn1r31 APN 6 58472724 missense possibly damaging 0.95
IGL02527:Vmn1r31 APN 6 58472793 missense probably benign 0.01
PIT4791001:Vmn1r31 UTSW 6 58472043 missense probably damaging 0.97
R0107:Vmn1r31 UTSW 6 58472743 missense probably benign 0.05
R1616:Vmn1r31 UTSW 6 58472058 missense probably damaging 0.97
R1883:Vmn1r31 UTSW 6 58472044 missense probably damaging 0.97
R1884:Vmn1r31 UTSW 6 58472044 missense probably damaging 0.97
R2942:Vmn1r31 UTSW 6 58472598 missense possibly damaging 0.87
R4589:Vmn1r31 UTSW 6 58472611 missense probably damaging 1.00
R4672:Vmn1r31 UTSW 6 58472071 missense probably damaging 0.97
R4676:Vmn1r31 UTSW 6 58472013 missense probably damaging 0.97
R4702:Vmn1r31 UTSW 6 58471968 makesense probably null
R4703:Vmn1r31 UTSW 6 58471968 makesense probably null
R4705:Vmn1r31 UTSW 6 58471968 makesense probably null
R6341:Vmn1r31 UTSW 6 58472010 missense probably benign 0.35
R6549:Vmn1r31 UTSW 6 58472663 missense possibly damaging 0.92
R7238:Vmn1r31 UTSW 6 58472873 missense
R7609:Vmn1r31 UTSW 6 58472470 missense probably damaging 0.97
R8438:Vmn1r31 UTSW 6 58472661 missense
R8936:Vmn1r31 UTSW 6 58472098 missense unknown
R9103:Vmn1r31 UTSW 6 58472088 missense unknown
Z1176:Vmn1r31 UTSW 6 58472391 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCCTCTGATGTCTGCACAAGATAATC -3'
(R):5'- CTGGACTTGGAGCCTTAGCCAATATG -3'

Sequencing Primer
(F):5'- AGGATTCAGTGACCTGCATC -3'
(R):5'- GAGCCTTAGCCAATATGTTTCTTC -3'
Posted On 2014-01-29