Incidental Mutation 'R1250:Prl2c2'
ID151730
Institutional Source Beutler Lab
Gene Symbol Prl2c2
Ensembl Gene ENSMUSG00000079092
Gene Nameprolactin family 2, subfamily c, member 2
SynonymsPlf, Plf1, MRP-1, PLF-1
MMRRC Submission 039317-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R1250 (G1)
Quality Score145
Status Not validated
Chromosome13
Chromosomal Location12996125-13005383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 13002201 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 47 (T47R)
Ref Sequence ENSEMBL: ENSMUSP00000152538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110594] [ENSMUST00000220558] [ENSMUST00000221612] [ENSMUST00000221627]
Predicted Effect probably damaging
Transcript: ENSMUST00000110594
AA Change: T47R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106224
Gene: ENSMUSG00000079092
AA Change: T47R

DomainStartEndE-ValueType
Pfam:Hormone_1 16 224 9.2e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000220558
AA Change: T45R

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000221612
AA Change: T47R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000221627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223124
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,925,975 probably null Het
Aptx T A 4: 40,693,447 E162D probably benign Het
Cdhr4 A T 9: 107,997,516 Q20L probably damaging Het
Dlk1 A T 12: 109,459,818 T206S probably damaging Het
Gabrr2 T C 4: 33,063,273 L32P probably benign Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Kntc1 T A 5: 123,784,199 S954T possibly damaging Het
Krt28 A G 11: 99,366,822 probably null Het
Lingo3 T C 10: 80,834,771 T442A probably benign Het
Map3k5 G A 10: 20,110,775 A912T possibly damaging Het
Msantd3 C A 4: 48,552,789 P126Q probably damaging Het
Nek10 T C 14: 14,853,887 S358P probably damaging Het
Qtrt1 C T 9: 21,419,548 T324M probably benign Het
Rag2 A G 2: 101,630,439 S365G probably damaging Het
Slc6a2 C A 8: 92,992,863 T402K probably benign Het
Slc9b1 T C 3: 135,348,770 M1T probably null Het
Ttn A G 2: 76,890,560 probably benign Het
Vmn1r31 A G 6: 58,472,658 V74A probably benign Het
Zkscan3 A G 13: 21,388,524 F313L probably benign Het
Other mutations in Prl2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Prl2c2 APN 13 13002243 missense probably damaging 1.00
R0991:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R0993:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1139:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1196:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1319:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1321:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1325:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1341:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1382:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1415:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1494:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1878:Prl2c2 UTSW 13 13005326 start codon destroyed probably damaging 0.99
R1950:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1983:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R1999:Prl2c2 UTSW 13 13002201 missense probably damaging 0.98
R3704:Prl2c2 UTSW 13 13002225 missense probably damaging 0.99
R4972:Prl2c2 UTSW 13 13002170 missense possibly damaging 0.74
R6170:Prl2c2 UTSW 13 13002172 missense probably damaging 0.99
R6766:Prl2c2 UTSW 13 13002128 splice site probably null
R7426:Prl2c2 UTSW 13 12997480 splice site probably null
R7635:Prl2c2 UTSW 13 12997343 missense probably damaging 0.98
R7842:Prl2c2 UTSW 13 13005322 missense probably benign 0.13
X0065:Prl2c2 UTSW 13 13002175 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGCTTTCTGCTTTAGGCTATGCACTA -3'
(R):5'- TCAGCACCCTGCCTTGAATCAAAT -3'

Sequencing Primer
(F):5'- CTATATCAACCATTGTGTTGGAGGC -3'
(R):5'- caaaacaaccaaccaaccaac -3'
Posted On2014-01-29