Mutagenetix > Incidental Mutations

Incidental Mutation 'R1251:Mcm3'

151734

Institutional Source

Beutler Lab

Gene Symbol

Mcm3

Ensembl Gene

ENSMUSG00000041859

Gene Name

minichromosome maintenance complex component 3

Synonyms

P1, p1.m, Mcmd

MMRRC Submission

039318-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1251 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20802968-20820312 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 20812672 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 353 (Q353*)

Ref Sequence

ENSEMBL: ENSMUSP00000059192 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053266]

Predicted Effect

probably null
Transcript: ENSMUST00000053266
AA Change: Q353*

SMART Domains

Protein: ENSMUSP00000059192
Gene: ENSMUSG00000041859
AA Change: Q353*

Domain	Start	End	E-Value	Type
MCM	109	654	N/A	SMART
AAA	337	490	1.92e-4	SMART
coiled coil region	655	693	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185296

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein is a subunit of the protein complex that consists of MCM2-7. It has been shown to interact directly with MCM5/CDC46. This protein also interacts with and is acetylated by MCM3AP, a chromatin-associated acetyltransferase. The acetylation of this protein inhibits the initiation of DNA replication and cell cycle progression. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null or hypomorph alleles exhibit prenatal lethality. Fetal mice homozygous for a hypomorphic allele display anemia and replicative stress during fetal erythropoiesis. Mice heterozygous for null or hypomorph alleles display increased incidence of lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Acap2	A	T	16: 31,108,171	Y509N	probably damaging	Het
Adcy9	T	A	16: 4,311,531	E497V	probably damaging	Het
Bcat2	T	G	7: 45,575,986	L56R	probably damaging	Het
Ccdc146	T	C	5: 21,293,372	M952V	probably benign	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Cfap46	C	T	7: 139,601,265	V2607I	probably benign	Het
Clec18a	T	C	8: 111,081,638	I54V	possibly damaging	Het
Coil	A	G	11: 88,982,299	E455G	possibly damaging	Het
Copg1	A	T	6: 87,890,007	K75*	probably null	Het
Cyp2j12	G	A	4: 96,115,666	Q238*	probably null	Het
D17Wsu92e	C	T	17: 27,786,070		probably null	Het
Eif3i	T	C	4: 129,593,385	E229G	probably damaging	Het
Exoc2	T	A	13: 30,886,276	N411Y	probably benign	Het
Eya2	T	A	2: 165,754,484	M305K	probably damaging	Het
Faim	C	T	9: 98,992,634	T78M	probably damaging	Het
Fgg	T	A	3: 83,012,980	D355E	probably benign	Het
Foxn1	A	G	11: 78,358,785	L638P	probably damaging	Het
Grid2ip	A	T	5: 143,386,015	E664D	possibly damaging	Het
Il1rn	A	G	2: 24,345,570	R21G	probably damaging	Het
Inpp4b	G	A	8: 81,890,753	G220R	probably benign	Het
Irx6	A	G	8: 92,678,253	S250G	possibly damaging	Het
Lyst	T	C	13: 13,634,483	I246T	probably benign	Het
Mfhas1	A	G	8: 35,591,053	Y894C	probably damaging	Het
Mfsd13a	T	C	19: 46,372,053	L348P	probably damaging	Het
Necab1	A	G	4: 15,111,192		probably null	Het
Nectin3	A	T	16: 46,463,842	S160T	possibly damaging	Het
Npc2	A	G	12: 84,760,884	S67P	probably damaging	Het
Olfr1036	G	A	2: 86,074,820	V27M	probably benign	Het
Olfr513	T	G	7: 108,754,907	F17C	probably damaging	Het
Pcnx3	A	G	19: 5,677,182	F1108L	probably benign	Het
Phf21a	G	A	2: 92,359,199	S601N	probably benign	Het
Pold1	C	T	7: 44,535,051	V842I	probably benign	Het
Rabgap1	A	G	2: 37,543,234		probably null	Het
Setd1a	T	A	7: 127,797,424		probably benign	Het
Sgo2a	A	T	1: 57,999,962		probably null	Het
Sult2a8	T	A	7: 14,425,425	K90*	probably null	Het
Tlr2	T	C	3: 83,838,269	D169G	possibly damaging	Het
Tmem95	A	G	11: 69,876,829	F153S	probably benign	Het
Tube1	G	T	10: 39,134,208	G10*	probably null	Het
Vmn2r10	T	C	5: 108,996,024	M687V	probably benign	Het
Zc3h8	G	A	2: 128,935,369	P117S	probably benign	Het
Zeb1	T	A	18: 5,705,089	D18E	probably damaging	Het

Other mutations in Mcm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01017:Mcm3	APN	1	20804815	critical splice donor site	probably null
IGL01061:Mcm3	APN	1	20814496	missense	possibly damaging	0.86
IGL01488:Mcm3	APN	1	20813056	missense	possibly damaging	0.90
IGL01609:Mcm3	APN	1	20814680	splice site	probably benign
IGL02483:Mcm3	APN	1	20803572	missense	possibly damaging	0.68
IGL02869:Mcm3	APN	1	20808839	missense	probably damaging	0.99
R0197:Mcm3	UTSW	1	20810105	missense	probably damaging	1.00
R0462:Mcm3	UTSW	1	20805332	missense	probably benign
R0467:Mcm3	UTSW	1	20804847	missense	probably benign
R0669:Mcm3	UTSW	1	20804929	splice site	probably null
R1599:Mcm3	UTSW	1	20820198	missense	probably benign	0.08
R1764:Mcm3	UTSW	1	20805879	missense	probably damaging	0.98
R2015:Mcm3	UTSW	1	20803580	missense	probably damaging	0.98
R2140:Mcm3	UTSW	1	20813110	missense	probably benign	0.00
R3033:Mcm3	UTSW	1	20808768	missense	probably damaging	1.00
R4430:Mcm3	UTSW	1	20811993	nonsense	probably null
R4513:Mcm3	UTSW	1	20810232	missense	probably damaging	1.00
R4563:Mcm3	UTSW	1	20809645	missense	probably benign
R4713:Mcm3	UTSW	1	20803577	missense	probably benign
R4801:Mcm3	UTSW	1	20810156	missense	probably damaging	0.99
R4802:Mcm3	UTSW	1	20810156	missense	probably damaging	0.99
R4896:Mcm3	UTSW	1	20820256	utr 5 prime	probably benign
R5035:Mcm3	UTSW	1	20803418	utr 3 prime	probably benign
R5461:Mcm3	UTSW	1	20814437	missense	probably benign	0.00
R5486:Mcm3	UTSW	1	20814894	missense	probably damaging	1.00
R5531:Mcm3	UTSW	1	20803544	missense	possibly damaging	0.46
R5759:Mcm3	UTSW	1	20808748	frame shift	probably null
R5760:Mcm3	UTSW	1	20808748	frame shift	probably null
R6505:Mcm3	UTSW	1	20803544	missense	probably damaging	1.00
R6833:Mcm3	UTSW	1	20810096	missense	possibly damaging	0.48
R6834:Mcm3	UTSW	1	20810096	missense	possibly damaging	0.48
R7179:Mcm3	UTSW	1	20814857	missense	probably damaging	0.98
R7514:Mcm3	UTSW	1	20805896	missense	probably benign	0.19
R7673:Mcm3	UTSW	1	20812014	missense	probably damaging	1.00
R7689:Mcm3	UTSW	1	20806773	missense	probably benign	0.29
R7718:Mcm3	UTSW	1	20817274	nonsense	probably null
R8411:Mcm3	UTSW	1	20816756	missense	probably benign	0.00
R8412:Mcm3	UTSW	1	20816756	missense	probably benign	0.00
R8441:Mcm3	UTSW	1	20814466	missense	probably benign	0.06
X0062:Mcm3	UTSW	1	20820137	missense	possibly damaging	0.49
Z1176:Mcm3	UTSW	1	20820181	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAGCGCCTAAGAGCTTGAAGAATC -3'
(R):5'- GGAACTTGAAAACGGCAGCCAC -3'

Sequencing Primer
(F):5'- GCTTGAAGAATCTAATCTGCTCACAC -3'
(R):5'- TTCTAGGCTCATCAACGTACAG -3'

Posted On

2014-01-29