Incidental Mutation 'R1251:Sgo2a'
ID151735
Institutional Source Beutler Lab
Gene Symbol Sgo2a
Ensembl Gene ENSMUSG00000026039
Gene Nameshugoshin 2A
SynonymsSgol2a, Sgol2, 1110007N04Rik, D1Ertd8e, 5730576N04Rik, Tripin
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location57995971-58025899 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 57999962 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027202] [ENSMUST00000163061]
Predicted Effect probably null
Transcript: ENSMUST00000027202
SMART Domains Protein: ENSMUSP00000027202
Gene: ENSMUSG00000026039

DomainStartEndE-ValueType
coiled coil region 54 109 N/A INTRINSIC
low complexity region 182 198 N/A INTRINSIC
low complexity region 371 381 N/A INTRINSIC
low complexity region 396 431 N/A INTRINSIC
low complexity region 583 597 N/A INTRINSIC
low complexity region 718 729 N/A INTRINSIC
low complexity region 1068 1078 N/A INTRINSIC
low complexity region 1112 1125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163061
SMART Domains Protein: ENSMUSP00000124053
Gene: ENSMUSG00000054770

DomainStartEndE-ValueType
BTB 23 123 1.01e-2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with abnormalities in meiosis but not in mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Sgo2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Sgo2a APN 1 58016594 missense probably damaging 1.00
IGL00534:Sgo2a APN 1 58016344 missense probably damaging 1.00
IGL00902:Sgo2a APN 1 58016099 missense probably benign 0.00
IGL01571:Sgo2a APN 1 58017974 missense probably damaging 0.99
IGL02268:Sgo2a APN 1 58017722 missense probably benign 0.10
IGL02756:Sgo2a APN 1 58016350 missense probably damaging 1.00
IGL02887:Sgo2a APN 1 58016352 missense probably damaging 0.99
IGL02991:Sgo2a APN 1 58015355 intron probably benign
crazy UTSW 1 58017795 missense probably benign 0.11
harpo UTSW 1 58019660 nonsense probably null
mashugana UTSW 1 58016567 missense probably damaging 1.00
meshugas UTSW 1 58002933 nonsense probably null
R0036:Sgo2a UTSW 1 58015628 missense probably benign 0.14
R0036:Sgo2a UTSW 1 58015628 missense probably benign 0.14
R0095:Sgo2a UTSW 1 58015555 missense probably benign 0.11
R0325:Sgo2a UTSW 1 58016697 missense probably benign
R0464:Sgo2a UTSW 1 58000094 missense probably damaging 0.98
R0699:Sgo2a UTSW 1 57998149 nonsense probably null
R1355:Sgo2a UTSW 1 58017965 missense possibly damaging 0.91
R1457:Sgo2a UTSW 1 58015806 missense probably benign 0.00
R2244:Sgo2a UTSW 1 58017054 missense probably benign 0.00
R3896:Sgo2a UTSW 1 58013646 missense probably damaging 0.99
R4919:Sgo2a UTSW 1 57998134 missense probably damaging 0.99
R5030:Sgo2a UTSW 1 58017759 nonsense probably null
R5123:Sgo2a UTSW 1 58016567 missense probably damaging 1.00
R5317:Sgo2a UTSW 1 58015524 missense probably benign
R5767:Sgo2a UTSW 1 58019660 nonsense probably null
R5844:Sgo2a UTSW 1 58016397 missense probably damaging 0.99
R6018:Sgo2a UTSW 1 58016959 missense probably benign 0.01
R6039:Sgo2a UTSW 1 58016616 missense possibly damaging 0.78
R6039:Sgo2a UTSW 1 58016616 missense possibly damaging 0.78
R6450:Sgo2a UTSW 1 58002933 nonsense probably null
R6998:Sgo2a UTSW 1 58016640 missense probably damaging 0.99
R7073:Sgo2a UTSW 1 58017785 missense possibly damaging 0.73
R7508:Sgo2a UTSW 1 58017795 missense probably benign 0.11
R7722:Sgo2a UTSW 1 58016537 missense probably benign 0.45
R8094:Sgo2a UTSW 1 58017141 missense possibly damaging 0.77
X0065:Sgo2a UTSW 1 58016358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCAAAACCTGGGCACGTT -3'
(R):5'- TGCTTATGGTGAGCAACCAAATGATGA -3'

Sequencing Primer
(F):5'- CAAAACCTGGGCACGTTTATTTTC -3'
(R):5'- tgggaggcagaggcagg -3'
Posted On2014-01-29