Mutagenetix > Incidental Mutation

Incidental Mutation 'R1251:Sgo2a'

151735

Institutional Source

Beutler Lab

Gene Symbol

Sgo2a

Ensembl Gene

ENSMUSG00000026039

Gene Name

shugoshin 2A

Synonyms

Sgol2a, Sgol2, 1110007N04Rik, D1Ertd8e, 5730576N04Rik, Tripin

MMRRC Submission

039318-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1251 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57995971-58025899 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to T at 57999962 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000027202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027202] [ENSMUST00000163061]

AlphaFold

Q7TSY8

Predicted Effect

probably null
Transcript: ENSMUST00000027202

SMART Domains

Protein: ENSMUSP00000027202
Gene: ENSMUSG00000026039

Domain	Start	End	E-Value	Type
coiled coil region	54	109	N/A	INTRINSIC
low complexity region	182	198	N/A	INTRINSIC
low complexity region	371	381	N/A	INTRINSIC
low complexity region	396	431	N/A	INTRINSIC
low complexity region	583	597	N/A	INTRINSIC
low complexity region	718	729	N/A	INTRINSIC
low complexity region	1068	1078	N/A	INTRINSIC
low complexity region	1112	1125	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163061

SMART Domains

Protein: ENSMUSP00000124053
Gene: ENSMUSG00000054770

Domain	Start	End	E-Value	Type
BTB	23	123	1.01e-2	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with abnormalities in meiosis but not in mitosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Acap2	A	T	16: 31,108,171	Y509N	probably damaging	Het
Adcy9	T	A	16: 4,311,531	E497V	probably damaging	Het
Bcat2	T	G	7: 45,575,986	L56R	probably damaging	Het
Ccdc146	T	C	5: 21,293,372	M952V	probably benign	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Cfap46	C	T	7: 139,601,265	V2607I	probably benign	Het
Clec18a	T	C	8: 111,081,638	I54V	possibly damaging	Het
Coil	A	G	11: 88,982,299	E455G	possibly damaging	Het
Copg1	A	T	6: 87,890,007	K75*	probably null	Het
Cyp2j12	G	A	4: 96,115,666	Q238*	probably null	Het
D17Wsu92e	C	T	17: 27,786,070		probably null	Het
Eif3i	T	C	4: 129,593,385	E229G	probably damaging	Het
Exoc2	T	A	13: 30,886,276	N411Y	probably benign	Het
Eya2	T	A	2: 165,754,484	M305K	probably damaging	Het
Faim	C	T	9: 98,992,634	T78M	probably damaging	Het
Fgg	T	A	3: 83,012,980	D355E	probably benign	Het
Foxn1	A	G	11: 78,358,785	L638P	probably damaging	Het
Grid2ip	A	T	5: 143,386,015	E664D	possibly damaging	Het
Il1rn	A	G	2: 24,345,570	R21G	probably damaging	Het
Inpp4b	G	A	8: 81,890,753	G220R	probably benign	Het
Irx6	A	G	8: 92,678,253	S250G	possibly damaging	Het
Lyst	T	C	13: 13,634,483	I246T	probably benign	Het
Mcm3	G	A	1: 20,812,672	Q353*	probably null	Het
Mfhas1	A	G	8: 35,591,053	Y894C	probably damaging	Het
Mfsd13a	T	C	19: 46,372,053	L348P	probably damaging	Het
Necab1	A	G	4: 15,111,192		probably null	Het
Nectin3	A	T	16: 46,463,842	S160T	possibly damaging	Het
Npc2	A	G	12: 84,760,884	S67P	probably damaging	Het
Olfr1036	G	A	2: 86,074,820	V27M	probably benign	Het
Olfr513	T	G	7: 108,754,907	F17C	probably damaging	Het
Pcnx3	A	G	19: 5,677,182	F1108L	probably benign	Het
Phf21a	G	A	2: 92,359,199	S601N	probably benign	Het
Pold1	C	T	7: 44,535,051	V842I	probably benign	Het
Rabgap1	A	G	2: 37,543,234		probably null	Het
Setd1a	T	A	7: 127,797,424		probably benign	Het
Sult2a8	T	A	7: 14,425,425	K90*	probably null	Het
Tlr2	T	C	3: 83,838,269	D169G	possibly damaging	Het
Tmem95	A	G	11: 69,876,829	F153S	probably benign	Het
Tube1	G	T	10: 39,134,208	G10*	probably null	Het
Vmn2r10	T	C	5: 108,996,024	M687V	probably benign	Het
Zc3h8	G	A	2: 128,935,369	P117S	probably benign	Het
Zeb1	T	A	18: 5,705,089	D18E	probably damaging	Het

Other mutations in Sgo2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Sgo2a	APN	1	58016594	missense	probably damaging	1.00
IGL00534:Sgo2a	APN	1	58016344	missense	probably damaging	1.00
IGL00902:Sgo2a	APN	1	58016099	missense	probably benign	0.00
IGL01571:Sgo2a	APN	1	58017974	missense	probably damaging	0.99
IGL02268:Sgo2a	APN	1	58017722	missense	probably benign	0.10
IGL02756:Sgo2a	APN	1	58016350	missense	probably damaging	1.00
IGL02887:Sgo2a	APN	1	58016352	missense	probably damaging	0.99
IGL02991:Sgo2a	APN	1	58015355	intron	probably benign
crazy	UTSW	1	58017795	missense	probably benign	0.11
harpo	UTSW	1	58019660	nonsense	probably null
mashugana	UTSW	1	58016567	missense	probably damaging	1.00
meshugas	UTSW	1	58002933	nonsense	probably null
R0036:Sgo2a	UTSW	1	58015628	missense	probably benign	0.14
R0036:Sgo2a	UTSW	1	58015628	missense	probably benign	0.14
R0095:Sgo2a	UTSW	1	58015555	missense	probably benign	0.11
R0325:Sgo2a	UTSW	1	58016697	missense	probably benign
R0464:Sgo2a	UTSW	1	58000094	missense	probably damaging	0.98
R0699:Sgo2a	UTSW	1	57998149	nonsense	probably null
R1355:Sgo2a	UTSW	1	58017965	missense	possibly damaging	0.91
R1457:Sgo2a	UTSW	1	58015806	missense	probably benign	0.00
R2244:Sgo2a	UTSW	1	58017054	missense	probably benign	0.00
R3896:Sgo2a	UTSW	1	58013646	missense	probably damaging	0.99
R4919:Sgo2a	UTSW	1	57998134	missense	probably damaging	0.99
R5030:Sgo2a	UTSW	1	58017759	nonsense	probably null
R5123:Sgo2a	UTSW	1	58016567	missense	probably damaging	1.00
R5317:Sgo2a	UTSW	1	58015524	missense	probably benign
R5767:Sgo2a	UTSW	1	58019660	nonsense	probably null
R5844:Sgo2a	UTSW	1	58016397	missense	probably damaging	0.99
R6018:Sgo2a	UTSW	1	58016959	missense	probably benign	0.01
R6039:Sgo2a	UTSW	1	58016616	missense	possibly damaging	0.78
R6039:Sgo2a	UTSW	1	58016616	missense	possibly damaging	0.78
R6450:Sgo2a	UTSW	1	58002933	nonsense	probably null
R6998:Sgo2a	UTSW	1	58016640	missense	probably damaging	0.99
R7073:Sgo2a	UTSW	1	58017785	missense	possibly damaging	0.73
R7508:Sgo2a	UTSW	1	58017795	missense	probably benign	0.11
R7722:Sgo2a	UTSW	1	58016537	missense	probably benign	0.45
R8094:Sgo2a	UTSW	1	58017141	missense	possibly damaging	0.77
R8782:Sgo2a	UTSW	1	58017457	start gained	probably benign
R8899:Sgo2a	UTSW	1	58019663	missense	possibly damaging	0.85
R8912:Sgo2a	UTSW	1	58017401	missense	probably damaging	0.99
R9106:Sgo2a	UTSW	1	57998124	missense	possibly damaging	0.59
R9256:Sgo2a	UTSW	1	58019613	missense	possibly damaging	0.77
X0065:Sgo2a	UTSW	1	58016358	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTTCAAAACCTGGGCACGTT -3'
(R):5'- TGCTTATGGTGAGCAACCAAATGATGA -3'

Sequencing Primer
(F):5'- CAAAACCTGGGCACGTTTATTTTC -3'
(R):5'- tgggaggcagaggcagg -3'

Posted On

2014-01-29