Incidental Mutation 'R1251:Rabgap1'
ID151737
Institutional Source Beutler Lab
Gene Symbol Rabgap1
Ensembl Gene ENSMUSG00000035437
Gene NameRAB GTPase activating protein 1
SynonymsGapcena
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location37443279-37566454 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 37543234 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061179] [ENSMUST00000066055] [ENSMUST00000112920] [ENSMUST00000183690]
Predicted Effect probably null
Transcript: ENSMUST00000061179
SMART Domains Protein: ENSMUSP00000061624
Gene: ENSMUSG00000035437

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 433 1.1e-38 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
TBC 558 770 9.27e-74 SMART
Blast:TBC 803 880 9e-33 BLAST
coiled coil region 986 1038 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000066055
SMART Domains Protein: ENSMUSP00000068835
Gene: ENSMUSG00000035437

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 433 7.1e-39 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
TBC 558 770 9.27e-74 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112920
SMART Domains Protein: ENSMUSP00000108542
Gene: ENSMUSG00000035437

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 432 1.6e-35 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
TBC 558 770 9.27e-74 SMART
Blast:TBC 803 880 9e-33 BLAST
coiled coil region 986 1038 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159092
Predicted Effect probably benign
Transcript: ENSMUST00000183690
SMART Domains Protein: ENSMUSP00000139145
Gene: ENSMUSG00000026915

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Rabgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Rabgap1 APN 2 37469546 missense probably damaging 1.00
IGL01456:Rabgap1 APN 2 37541175 missense probably damaging 0.99
IGL01599:Rabgap1 APN 2 37556269 missense probably damaging 1.00
IGL01834:Rabgap1 APN 2 37564761 intron probably benign
IGL01940:Rabgap1 APN 2 37487067 missense probably damaging 1.00
IGL02416:Rabgap1 APN 2 37561950 missense probably benign 0.00
IGL02683:Rabgap1 APN 2 37502939 missense probably damaging 1.00
IGL02755:Rabgap1 APN 2 37537314 missense probably damaging 0.98
IGL02999:Rabgap1 APN 2 37483826 missense possibly damaging 0.56
IGL03144:Rabgap1 APN 2 37540532 missense probably damaging 0.99
IGL02796:Rabgap1 UTSW 2 37472306 missense probably damaging 0.99
R0117:Rabgap1 UTSW 2 37561885 splice site probably null
R0455:Rabgap1 UTSW 2 37487120 missense probably damaging 1.00
R0569:Rabgap1 UTSW 2 37489717 intron probably benign
R0586:Rabgap1 UTSW 2 37543223 missense probably benign
R0962:Rabgap1 UTSW 2 37560469 intron probably benign
R1055:Rabgap1 UTSW 2 37492068 missense possibly damaging 0.91
R1086:Rabgap1 UTSW 2 37469446 missense probably damaging 0.99
R1598:Rabgap1 UTSW 2 37561899 missense probably damaging 1.00
R1924:Rabgap1 UTSW 2 37495759 critical splice donor site probably null
R1957:Rabgap1 UTSW 2 37483762 missense possibly damaging 0.93
R2134:Rabgap1 UTSW 2 37563487 nonsense probably null
R2154:Rabgap1 UTSW 2 37475441 missense probably damaging 1.00
R4328:Rabgap1 UTSW 2 37532615 missense probably damaging 1.00
R4351:Rabgap1 UTSW 2 37483782 missense probably benign
R4658:Rabgap1 UTSW 2 37487549 nonsense probably null
R4821:Rabgap1 UTSW 2 37532519 missense probably damaging 1.00
R4897:Rabgap1 UTSW 2 37560571 missense probably benign 0.01
R5014:Rabgap1 UTSW 2 37487140 missense probably damaging 1.00
R5252:Rabgap1 UTSW 2 37475357 missense probably benign 0.11
R5392:Rabgap1 UTSW 2 37469489 missense probably damaging 1.00
R5794:Rabgap1 UTSW 2 37502902 missense probably benign 0.03
R5941:Rabgap1 UTSW 2 37561896 missense possibly damaging 0.62
R6002:Rabgap1 UTSW 2 37473602 missense probably benign 0.05
R6209:Rabgap1 UTSW 2 37563598 nonsense probably null
R6317:Rabgap1 UTSW 2 37542647 missense possibly damaging 0.88
R7011:Rabgap1 UTSW 2 37540480 missense probably damaging 1.00
R7014:Rabgap1 UTSW 2 37560563 missense probably benign 0.08
R7514:Rabgap1 UTSW 2 37537342 missense probably damaging 1.00
R7543:Rabgap1 UTSW 2 37469432 missense probably damaging 0.99
R7599:Rabgap1 UTSW 2 37502896 frame shift probably null
R7709:Rabgap1 UTSW 2 37537327 missense possibly damaging 0.89
R7784:Rabgap1 UTSW 2 37487532 missense possibly damaging 0.91
R7816:Rabgap1 UTSW 2 37563464 missense probably benign 0.01
R7834:Rabgap1 UTSW 2 37469407 intron probably benign
R7869:Rabgap1 UTSW 2 37487130 missense probably benign 0.31
R7888:Rabgap1 UTSW 2 37537307 nonsense probably null
R7949:Rabgap1 UTSW 2 37563479 missense probably benign 0.44
R8084:Rabgap1 UTSW 2 37537305 missense probably damaging 1.00
R8333:Rabgap1 UTSW 2 37495698 missense probably benign
R8440:Rabgap1 UTSW 2 37542680 critical splice donor site probably null
Z1176:Rabgap1 UTSW 2 37560544 missense probably benign 0.06
Z1177:Rabgap1 UTSW 2 37469528 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTAAGAGGTCATTGTGCTCCTGTG -3'
(R):5'- AGTTTCCAATATACTCTGGCAGCAACC -3'

Sequencing Primer
(F):5'- atccacctgcctctgcc -3'
(R):5'- CCATTTACAAAAAGGGGCACTTG -3'
Posted On2014-01-29