Incidental Mutation 'R1251:Olfr1036'
ID151739
Institutional Source Beutler Lab
Gene Symbol Olfr1036
Ensembl Gene ENSMUSG00000099820
Gene Nameolfactory receptor 1036
SynonymsGA_x6K02T2Q125-47549689-47550621, MOR245-25, MOR262-13
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86073992-86077194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86074820 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 27 (V27M)
Ref Sequence ENSEMBL: ENSMUSP00000130843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164985]
Predicted Effect probably benign
Transcript: ENSMUST00000164985
AA Change: V27M

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130843
Gene: ENSMUSG00000099820
AA Change: V27M

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.2e-51 PFAM
Pfam:7tm_1 39 288 1.1e-21 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Olfr1036
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Olfr1036 APN 2 86075472 missense possibly damaging 0.90
IGL02370:Olfr1036 APN 2 86074788 missense probably damaging 0.98
R0269:Olfr1036 UTSW 2 86075141 missense probably benign 0.03
R0409:Olfr1036 UTSW 2 86075302 nonsense probably null
R0412:Olfr1036 UTSW 2 86075091 missense probably benign 0.16
R0617:Olfr1036 UTSW 2 86075141 missense probably benign 0.03
R0846:Olfr1036 UTSW 2 86075166 missense possibly damaging 0.66
R1646:Olfr1036 UTSW 2 86075616 missense probably damaging 0.98
R1670:Olfr1036 UTSW 2 86075250 missense probably benign
R1775:Olfr1036 UTSW 2 86074760 missense possibly damaging 0.88
R1968:Olfr1036 UTSW 2 86075205 missense probably damaging 1.00
R2877:Olfr1036 UTSW 2 86075331 missense possibly damaging 0.82
R4639:Olfr1036 UTSW 2 86075579 missense probably benign 0.24
R4957:Olfr1036 UTSW 2 86075510 missense probably damaging 1.00
R5267:Olfr1036 UTSW 2 86075538 missense probably benign 0.28
R5862:Olfr1036 UTSW 2 86075646 missense probably benign 0.00
R6235:Olfr1036 UTSW 2 86075166 missense possibly damaging 0.66
R6355:Olfr1036 UTSW 2 86074872 missense probably benign 0.04
R6943:Olfr1036 UTSW 2 86074920 missense probably damaging 1.00
R8033:Olfr1036 UTSW 2 86074875 missense possibly damaging 0.61
R8796:Olfr1036 UTSW 2 86075174 missense possibly damaging 0.94
Z1088:Olfr1036 UTSW 2 86075323 missense possibly damaging 0.66
Z1177:Olfr1036 UTSW 2 86075424 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCTACCCTGTAACACATTTGAACATT -3'
(R):5'- TCGAAGGCCATCACTGCCAGAATA -3'

Sequencing Primer
(F):5'- CCTGTAACACATTTGAACATTTAGAC -3'
(R):5'- AGTAGCACTGTACCAAGCATC -3'
Posted On2014-01-29