Incidental Mutation 'R1251:Phf21a'
ID151740
Institutional Source Beutler Lab
Gene Symbol Phf21a
Ensembl Gene ENSMUSG00000058318
Gene NamePHD finger protein 21A
SynonymsPFTF1, Bhc80, Braf35/HDAC complex (Bhc), 80kDa, D030065N23Rik
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location92093117-92364666 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 92359199 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 601 (S601N)
Ref Sequence ENSEMBL: ENSMUSP00000106924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044036] [ENSMUST00000068702] [ENSMUST00000090586] [ENSMUST00000111290] [ENSMUST00000111291] [ENSMUST00000111292] [ENSMUST00000111293] [ENSMUST00000111294] [ENSMUST00000111297] [ENSMUST00000159961]
Predicted Effect probably benign
Transcript: ENSMUST00000044036
AA Change: S517N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038497
Gene: ENSMUSG00000058318
AA Change: S517N

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 165 186 N/A INTRINSIC
AT_hook 350 362 4.28e-1 SMART
low complexity region 369 381 N/A INTRINSIC
PHD 415 458 3.12e-15 SMART
RING 416 457 1.85e-1 SMART
coiled coil region 482 527 N/A INTRINSIC
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068702
AA Change: S469N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070649
Gene: ENSMUSG00000058318
AA Change: S469N

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
PHD 367 410 3.12e-15 SMART
RING 368 409 1.85e-1 SMART
coiled coil region 434 479 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090586
AA Change: S601N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088074
Gene: ENSMUSG00000058318
AA Change: S601N

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 434 446 4.28e-1 SMART
low complexity region 453 465 N/A INTRINSIC
PHD 499 542 3.12e-15 SMART
RING 500 541 1.85e-1 SMART
coiled coil region 566 611 N/A INTRINSIC
low complexity region 659 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111290
AA Change: S572N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106921
Gene: ENSMUSG00000058318
AA Change: S572N

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 405 417 4.28e-1 SMART
low complexity region 424 436 N/A INTRINSIC
PHD 470 513 3.12e-15 SMART
RING 471 512 1.85e-1 SMART
coiled coil region 537 582 N/A INTRINSIC
low complexity region 630 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111291
AA Change: S517N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106922
Gene: ENSMUSG00000058318
AA Change: S517N

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 165 186 N/A INTRINSIC
AT_hook 350 362 4.28e-1 SMART
low complexity region 369 381 N/A INTRINSIC
PHD 415 458 3.12e-15 SMART
RING 416 457 1.85e-1 SMART
coiled coil region 482 527 N/A INTRINSIC
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111292
AA Change: S469N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106923
Gene: ENSMUSG00000058318
AA Change: S469N

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
PHD 367 410 3.12e-15 SMART
RING 368 409 1.85e-1 SMART
coiled coil region 434 479 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111293
AA Change: S601N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106924
Gene: ENSMUSG00000058318
AA Change: S601N

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 434 446 4.28e-1 SMART
low complexity region 453 465 N/A INTRINSIC
PHD 499 542 3.12e-15 SMART
RING 500 541 1.85e-1 SMART
coiled coil region 566 611 N/A INTRINSIC
low complexity region 659 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111294
AA Change: S554N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106925
Gene: ENSMUSG00000058318
AA Change: S554N

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
PHD 452 495 3.12e-15 SMART
RING 453 494 1.85e-1 SMART
coiled coil region 519 564 N/A INTRINSIC
low complexity region 612 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111297
AA Change: S524N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106928
Gene: ENSMUSG00000058318
AA Change: S524N

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
PHD 422 465 3.12e-15 SMART
RING 423 464 1.85e-1 SMART
coiled coil region 489 534 N/A INTRINSIC
low complexity region 582 602 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159961
AA Change: S488N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123955
Gene: ENSMUSG00000058318
AA Change: S488N

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
low complexity region 57 100 N/A INTRINSIC
low complexity region 136 157 N/A INTRINSIC
AT_hook 321 333 4.28e-1 SMART
low complexity region 340 352 N/A INTRINSIC
PHD 386 429 3.12e-15 SMART
RING 387 428 1.85e-1 SMART
coiled coil region 453 498 N/A INTRINSIC
low complexity region 546 566 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161044
Predicted Effect probably benign
Transcript: ENSMUST00000161067
SMART Domains Protein: ENSMUSP00000124255
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
PHD 140 183 3.12e-15 SMART
RING 141 182 1.85e-1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The PHF21A gene encodes BHC80, a component of a BRAF35 (MIM 605535)/histone deacetylase (HDAC; see MIM 601241) complex (BHC) that mediates repression of neuron-specific genes through the cis-regulatory element known as repressor element-1 (RE1) or neural restrictive silencer (NRS) (Hakimi et al., 2002 [PubMed 12032298]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality and insufficient milk-sucking behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Phf21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Phf21a APN 2 92348029 missense probably damaging 1.00
IGL00826:Phf21a APN 2 92344536 splice site probably benign
IGL01859:Phf21a APN 2 92328356 missense probably damaging 1.00
IGL02124:Phf21a APN 2 92349422 missense probably damaging 1.00
IGL02724:Phf21a APN 2 92360247 missense probably damaging 1.00
IGL03155:Phf21a APN 2 92320266 missense probably damaging 0.99
R0308:Phf21a UTSW 2 92330777 missense possibly damaging 0.86
R1739:Phf21a UTSW 2 92360299 missense possibly damaging 0.95
R1775:Phf21a UTSW 2 92330515 missense probably damaging 1.00
R2013:Phf21a UTSW 2 92228483 critical splice donor site probably null
R2064:Phf21a UTSW 2 92327077 missense possibly damaging 0.47
R2073:Phf21a UTSW 2 92348036 missense probably damaging 1.00
R4698:Phf21a UTSW 2 92356952 missense probably damaging 1.00
R4901:Phf21a UTSW 2 92357001 nonsense probably null
R5055:Phf21a UTSW 2 92351856 missense probably damaging 1.00
R5249:Phf21a UTSW 2 92228477 missense probably damaging 1.00
R5401:Phf21a UTSW 2 92351752 missense possibly damaging 0.71
R5770:Phf21a UTSW 2 92351854 missense possibly damaging 0.52
R5969:Phf21a UTSW 2 92221611 missense probably damaging 0.98
R6008:Phf21a UTSW 2 92351752 missense possibly damaging 0.71
R6012:Phf21a UTSW 2 92351775 missense probably damaging 1.00
R6128:Phf21a UTSW 2 92351608 critical splice acceptor site probably null
R6354:Phf21a UTSW 2 92348937 missense probably damaging 1.00
R7075:Phf21a UTSW 2 92360379 nonsense probably null
R7117:Phf21a UTSW 2 92359157 missense probably benign 0.25
R7270:Phf21a UTSW 2 92327139 missense probably damaging 0.98
R7603:Phf21a UTSW 2 92357007 missense probably benign 0.08
R7708:Phf21a UTSW 2 92327166 critical splice donor site probably null
R7946:Phf21a UTSW 2 92359167 missense probably damaging 0.99
Z1177:Phf21a UTSW 2 92230714 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAGCAGACACTTTCAGGGC -3'
(R):5'- GGTGCAACTGGTATCCCATCTCTTC -3'

Sequencing Primer
(F):5'- CTGGTATCTTTGGTGAACAAAGCC -3'
(R):5'- TCTTCCCCAGCAGACTGAC -3'
Posted On2014-01-29