Incidental Mutation 'R1251:Eya2'
ID151742
Institutional Source Beutler Lab
Gene Symbol Eya2
Ensembl Gene ENSMUSG00000017897
Gene NameEYA transcriptional coactivator and phosphatase 2
Synonyms
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.867) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location165595032-165771727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 165754484 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 305 (M305K)
Ref Sequence ENSEMBL: ENSMUSP00000085455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063433] [ENSMUST00000088132]
Predicted Effect probably damaging
Transcript: ENSMUST00000063433
AA Change: M305K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066244
Gene: ENSMUSG00000017897
AA Change: M305K

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
PDB:4EGC|B 247 532 N/A PDB
SCOP:d1lvha_ 367 511 3e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000088132
AA Change: M305K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085455
Gene: ENSMUSG00000017897
AA Change: M305K

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
Pfam:Hydrolase 262 508 1.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150638
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the eyes absent protein family. The encoded protein is a tyrosine phosphatase which acts as a transcriptional activator during development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Eya2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Eya2 APN 2 165754481 missense probably damaging 1.00
IGL02368:Eya2 APN 2 165763718 missense probably damaging 1.00
IGL02465:Eya2 APN 2 165715952 missense possibly damaging 0.89
IGL02523:Eya2 APN 2 165754436 splice site probably benign
Needle UTSW 2 165763816 missense probably damaging 1.00
R0048:Eya2 UTSW 2 165716011 missense probably damaging 1.00
R0167:Eya2 UTSW 2 165716112 missense possibly damaging 0.89
R0479:Eya2 UTSW 2 165715956 nonsense probably null
R0600:Eya2 UTSW 2 165769237 missense probably damaging 1.00
R0909:Eya2 UTSW 2 165754493 missense probably benign 0.28
R1332:Eya2 UTSW 2 165687608 splice site probably benign
R1725:Eya2 UTSW 2 165724685 missense probably benign
R1729:Eya2 UTSW 2 165687663 missense probably damaging 1.00
R1730:Eya2 UTSW 2 165687663 missense probably damaging 1.00
R1739:Eya2 UTSW 2 165687663 missense probably damaging 1.00
R1765:Eya2 UTSW 2 165724803 missense probably damaging 0.99
R1879:Eya2 UTSW 2 165664806 missense probably benign
R1969:Eya2 UTSW 2 165716119 missense probably benign 0.00
R2430:Eya2 UTSW 2 165716130 critical splice donor site probably null
R4285:Eya2 UTSW 2 165724780 missense probably benign 0.01
R5137:Eya2 UTSW 2 165731628 missense probably damaging 1.00
R5574:Eya2 UTSW 2 165763816 missense probably damaging 1.00
R5739:Eya2 UTSW 2 165761937 missense probably damaging 1.00
R5943:Eya2 UTSW 2 165724689 missense probably damaging 0.99
R6259:Eya2 UTSW 2 165716099 missense probably benign 0.00
R6477:Eya2 UTSW 2 165763761 missense probably benign
R6736:Eya2 UTSW 2 165716037 missense possibly damaging 0.80
R7347:Eya2 UTSW 2 165687666 missense probably benign 0.00
R7524:Eya2 UTSW 2 165769326 critical splice donor site probably null
R7563:Eya2 UTSW 2 165716130 critical splice donor site probably null
R7612:Eya2 UTSW 2 165687737 critical splice donor site probably null
R8420:Eya2 UTSW 2 165767068 missense probably damaging 1.00
Z1177:Eya2 UTSW 2 165685593 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACACAAGAGCTGAGAGCTATC -3'
(R):5'- CATTCCATGTGACTGGAGCAGAGAG -3'

Sequencing Primer
(F):5'- GTGCAGAAAACTGTCCCTTC -3'
(R):5'- GTAACCCCAGCAACTGTGAA -3'
Posted On2014-01-29