Incidental Mutation 'R1251:Fgg'
ID151744
Institutional Source Beutler Lab
Gene Symbol Fgg
Ensembl Gene ENSMUSG00000033860
Gene Namefibrinogen gamma chain
Synonymsgamma-fibrinogen, 3010002H13Rik
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location83007724-83015049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83012980 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 355 (D355E)
Ref Sequence ENSEMBL: ENSMUSP00000141648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048486] [ENSMUST00000194175]
Predicted Effect probably benign
Transcript: ENSMUST00000048486
AA Change: D355E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000037018
Gene: ENSMUSG00000033860
AA Change: D355E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Fib_alpha 28 172 1.09e-72 SMART
FBG 173 414 6.77e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193581
Predicted Effect probably benign
Transcript: ENSMUST00000194175
AA Change: D355E

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000141648
Gene: ENSMUSG00000033860
AA Change: D355E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Fib_alpha 28 172 1.09e-72 SMART
FBG 173 414 6.77e-130 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the gamma subunit of the coagulation factor fibrinogen, which is a component of the blood clot. Mice lacking the encoded protein did not possess detectable amounts of plasma fibrinogen. Pregnant mice lacking the encoded protein die due to heavy bleeding during delivery. This gene is located adjacent to the genes encoding fibrinogen alpha and gamma subunits on chromosome 3. Alternate splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2015]
PHENOTYPE: Pregnant homozygous null mice exhibit retarded embryo-placental development, spontaneous abortion, and maternal death through excessive uterine bleeding. Mutants expressing a truncated polypeptide show reduced platelet aggregation, increased bleeding time, and occasional fatal neonatal bleeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Fgg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Fgg APN 3 83014228 missense possibly damaging 0.67
IGL01713:Fgg APN 3 83008416 missense probably benign 0.20
IGL02288:Fgg APN 3 83008153 missense probably benign 0.11
IGL02994:Fgg APN 3 83008474 missense probably benign
PIT4519001:Fgg UTSW 3 83012939 missense probably damaging 1.00
R2137:Fgg UTSW 3 83008438 missense possibly damaging 0.78
R2400:Fgg UTSW 3 83008187 missense possibly damaging 0.94
R2436:Fgg UTSW 3 83014189 missense possibly damaging 0.94
R3429:Fgg UTSW 3 83012783 missense probably damaging 1.00
R4356:Fgg UTSW 3 83012943 missense probably damaging 1.00
R4612:Fgg UTSW 3 83010090 missense probably damaging 1.00
R4613:Fgg UTSW 3 83010090 missense probably damaging 1.00
R4828:Fgg UTSW 3 83008370 splice site probably benign
R4898:Fgg UTSW 3 83008540 missense probably benign 0.02
R4938:Fgg UTSW 3 83012868 missense probably benign 0.00
R4967:Fgg UTSW 3 83012765 missense probably benign 0.33
R5635:Fgg UTSW 3 83011423 missense probably benign 0.07
R5740:Fgg UTSW 3 83011525 missense probably benign 0.01
R6307:Fgg UTSW 3 83012976 missense probably damaging 0.98
R6731:Fgg UTSW 3 83012901 missense probably damaging 1.00
R6936:Fgg UTSW 3 83008420 missense possibly damaging 0.82
R7582:Fgg UTSW 3 83014138 missense probably damaging 1.00
R7769:Fgg UTSW 3 83013126 splice site probably null
R8258:Fgg UTSW 3 83010170 nonsense probably null
R8259:Fgg UTSW 3 83010170 nonsense probably null
R8290:Fgg UTSW 3 83012834 missense probably benign 0.00
R8810:Fgg UTSW 3 83013015 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGACAAATACCGCCTGACCTATGC -3'
(R):5'- GCTGAGCCAGGGTAATGTATCCATC -3'

Sequencing Primer
(F):5'- TGACCTATGCCTACTTCATTGG -3'
(R):5'- AGGGTAATGTATCCATCCACAAG -3'
Posted On2014-01-29