Incidental Mutation 'R1251:Cyp2j12'
ID151747
Institutional Source Beutler Lab
Gene Symbol Cyp2j12
Ensembl Gene ENSMUSG00000081225
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 12
SynonymsOTTMUSG00000007939, Cyp2j12-ps
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location96099318-96141152 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 96115666 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 238 (Q238*)
Ref Sequence ENSEMBL: ENSMUSP00000133811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097972] [ENSMUST00000121694]
Predicted Effect probably null
Transcript: ENSMUST00000097972
AA Change: Q238*
SMART Domains Protein: ENSMUSP00000133811
Gene: ENSMUSG00000081225
AA Change: Q238*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 44 498 8.2e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121694
SMART Domains Protein: ENSMUSP00000134394
Gene: ENSMUSG00000081225

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
SCOP:d1cpt__ 39 70 2e-8 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Cyp2j12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Cyp2j12 APN 4 96106589 splice site probably benign
IGL01655:Cyp2j12 APN 4 96115577 missense possibly damaging 0.79
IGL01723:Cyp2j12 APN 4 96102126 missense possibly damaging 0.56
IGL01737:Cyp2j12 APN 4 96122658 makesense probably null
IGL01936:Cyp2j12 APN 4 96133069 missense probably benign 0.01
IGL01962:Cyp2j12 APN 4 96099762 missense probably benign 0.10
IGL02691:Cyp2j12 APN 4 96132994 critical splice donor site probably null
R0255:Cyp2j12 UTSW 4 96141025 missense probably benign 0.38
R0613:Cyp2j12 UTSW 4 96102079 missense probably damaging 1.00
R0827:Cyp2j12 UTSW 4 96112862 splice site probably benign
R1016:Cyp2j12 UTSW 4 96112865 critical splice donor site probably null
R1753:Cyp2j12 UTSW 4 96121432 splice site probably null
R2258:Cyp2j12 UTSW 4 96133078 missense probably damaging 1.00
R4471:Cyp2j12 UTSW 4 96133069 missense probably benign 0.01
R4559:Cyp2j12 UTSW 4 96112957 missense probably damaging 0.99
R4702:Cyp2j12 UTSW 4 96132993 critical splice donor site probably null
R4923:Cyp2j12 UTSW 4 96102109 missense possibly damaging 0.91
R4928:Cyp2j12 UTSW 4 96102151 splice site probably null
R5591:Cyp2j12 UTSW 4 96141122 start gained probably benign
R5897:Cyp2j12 UTSW 4 96102042 missense probably damaging 1.00
R6176:Cyp2j12 UTSW 4 96140837 missense probably damaging 0.99
R6942:Cyp2j12 UTSW 4 96112864 critical splice donor site probably null
R7422:Cyp2j12 UTSW 4 96140985 missense probably benign 0.05
R7453:Cyp2j12 UTSW 4 96102126 missense possibly damaging 0.95
R7839:Cyp2j12 UTSW 4 96099656 missense possibly damaging 0.94
R8437:Cyp2j12 UTSW 4 96099662 missense probably damaging 1.00
R8445:Cyp2j12 UTSW 4 96133022 missense possibly damaging 0.82
R8683:Cyp2j12 UTSW 4 96121568 missense probably benign 0.41
R8701:Cyp2j12 UTSW 4 96121573 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GGAAGACCCAGACCACTTGTCCTC -3'
(R):5'- TGGGATCATAAAACCTGCCCTGTTC -3'

Sequencing Primer
(F):5'- CCTCACCTTTGACATTTCTGTAAG -3'
(R):5'- TGCATGGCACTGTTGAAACAC -3'
Posted On2014-01-29