Incidental Mutation 'R1251:Eif3i'
ID151748
Institutional Source Beutler Lab
Gene Symbol Eif3i
Ensembl Gene ENSMUSG00000028798
Gene Nameeukaryotic translation initiation factor 3, subunit I
SynonymsEif3s2, 36kDa, TRIP-1, D4Ertd632e
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129591960-129600648 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129593385 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 229 (E229G)
Ref Sequence ENSEMBL: ENSMUSP00000099653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102593] [ENSMUST00000135055]
Predicted Effect probably damaging
Transcript: ENSMUST00000102593
AA Change: E229G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099653
Gene: ENSMUSG00000028798
AA Change: E229G

DomainStartEndE-ValueType
WD40 1 38 1.1e1 SMART
WD40 41 80 1.07e-8 SMART
WD40 135 174 3.84e0 SMART
WD40 177 216 6.63e-5 SMART
Blast:WD40 219 257 2e-18 BLAST
WD40 274 313 3.75e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135055
SMART Domains Protein: ENSMUSP00000120776
Gene: ENSMUSG00000028798

DomainStartEndE-ValueType
WD40 2 32 1.54e0 SMART
Blast:WD40 35 78 1e-9 BLAST
WD40 87 126 3.84e0 SMART
WD40 129 163 8.25e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155428
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Eif3i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Eif3i APN 4 129595069 missense probably benign
IGL02222:Eif3i APN 4 129592088 missense possibly damaging 0.89
IGL02975:Eif3i APN 4 129595312 missense probably damaging 0.99
R0683:Eif3i UTSW 4 129593535 missense probably benign 0.12
R0783:Eif3i UTSW 4 129592076 missense possibly damaging 0.85
R0920:Eif3i UTSW 4 129595257 splice site probably benign
R2132:Eif3i UTSW 4 129596926 missense probably benign 0.02
R2133:Eif3i UTSW 4 129596926 missense probably benign 0.02
R3978:Eif3i UTSW 4 129592336 missense probably damaging 1.00
R4781:Eif3i UTSW 4 129595273 missense probably benign 0.11
R4808:Eif3i UTSW 4 129592064 missense probably benign 0.15
R5096:Eif3i UTSW 4 129600444 missense probably damaging 0.97
R5335:Eif3i UTSW 4 129595186 missense probably benign 0.20
R6048:Eif3i UTSW 4 129593352 missense probably benign 0.01
R7087:Eif3i UTSW 4 129592311 missense probably damaging 1.00
R7503:Eif3i UTSW 4 129600414 missense probably damaging 0.97
R8798:Eif3i UTSW 4 129596924 missense probably benign 0.00
RF012:Eif3i UTSW 4 129592079 missense probably damaging 1.00
RF019:Eif3i UTSW 4 129600465 missense probably damaging 1.00
Z1176:Eif3i UTSW 4 129600575 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTAAGCAGCCATGTCAAGGACCTC -3'
(R):5'- AACGTAAAGGAACACTCTCGGCAG -3'

Sequencing Primer
(F):5'- ATGTCAAGGACCTCCTGCC -3'
(R):5'- TCCAGTTGTCTAGAGACATGACC -3'
Posted On2014-01-29