Incidental Mutation 'R1251:Ccdc146'
ID151749
Institutional Source Beutler Lab
Gene Symbol Ccdc146
Ensembl Gene ENSMUSG00000064280
Gene Namecoiled-coil domain containing 146
Synonyms4930528G09Rik
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location21292961-21424677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21293372 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 952 (M952V)
Ref Sequence ENSEMBL: ENSMUSP00000110900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036031] [ENSMUST00000115245] [ENSMUST00000195969] [ENSMUST00000198014] [ENSMUST00000198930] [ENSMUST00000198937]
Predicted Effect probably benign
Transcript: ENSMUST00000036031
SMART Domains Protein: ENSMUSP00000043679
Gene: ENSMUSG00000039934

DomainStartEndE-ValueType
low complexity region 386 398 N/A INTRINSIC
Pfam:GSAP-16 646 753 6.8e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115245
AA Change: M952V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110900
Gene: ENSMUSG00000064280
AA Change: M952V

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 120 130 N/A INTRINSIC
coiled coil region 194 320 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
coiled coil region 438 477 N/A INTRINSIC
coiled coil region 549 595 N/A INTRINSIC
coiled coil region 617 663 N/A INTRINSIC
coiled coil region 690 720 N/A INTRINSIC
coiled coil region 770 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195969
Predicted Effect probably benign
Transcript: ENSMUST00000198014
Predicted Effect probably benign
Transcript: ENSMUST00000198930
Predicted Effect probably benign
Transcript: ENSMUST00000198937
SMART Domains Protein: ENSMUSP00000142986
Gene: ENSMUSG00000039934

DomainStartEndE-ValueType
low complexity region 355 367 N/A INTRINSIC
Pfam:GSAP-16 608 722 1.6e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199553
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Ccdc146
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ccdc146 APN 5 21301422 missense possibly damaging 0.93
IGL01066:Ccdc146 APN 5 21319542 missense probably benign 0.03
IGL01399:Ccdc146 APN 5 21294613 missense possibly damaging 0.75
IGL01866:Ccdc146 APN 5 21333054 missense probably damaging 0.99
IGL01868:Ccdc146 APN 5 21333054 missense probably damaging 0.99
IGL01869:Ccdc146 APN 5 21316839 missense probably benign 0.25
IGL02213:Ccdc146 APN 5 21316904 missense probably benign 0.10
IGL02338:Ccdc146 APN 5 21319606 unclassified probably benign
IGL02553:Ccdc146 APN 5 21297633 missense probably benign 0.00
IGL02838:Ccdc146 APN 5 21297569 missense probably benign 0.01
Starcraft UTSW 5 21399614 splice site probably null
R0051:Ccdc146 UTSW 5 21316904 missense possibly damaging 0.58
R0051:Ccdc146 UTSW 5 21316904 missense possibly damaging 0.58
R0055:Ccdc146 UTSW 5 21297006 splice site probably null
R0115:Ccdc146 UTSW 5 21322756 missense possibly damaging 0.87
R0373:Ccdc146 UTSW 5 21319545 missense probably benign 0.00
R1355:Ccdc146 UTSW 5 21321242 missense probably damaging 1.00
R1405:Ccdc146 UTSW 5 21399732 missense probably benign 0.00
R1405:Ccdc146 UTSW 5 21399732 missense probably benign 0.00
R1470:Ccdc146 UTSW 5 21319566 missense probably damaging 1.00
R1470:Ccdc146 UTSW 5 21319566 missense probably damaging 1.00
R1556:Ccdc146 UTSW 5 21330553 missense probably damaging 1.00
R1613:Ccdc146 UTSW 5 21294524 missense probably damaging 0.99
R1872:Ccdc146 UTSW 5 21301290 missense probably benign 0.01
R2271:Ccdc146 UTSW 5 21399721 missense probably benign 0.15
R2329:Ccdc146 UTSW 5 21308612 critical splice donor site probably null
R2518:Ccdc146 UTSW 5 21305528 missense probably benign
R2680:Ccdc146 UTSW 5 21305269 missense possibly damaging 0.58
R3116:Ccdc146 UTSW 5 21316955 missense probably benign 0.02
R3121:Ccdc146 UTSW 5 21294593 missense possibly damaging 0.56
R3122:Ccdc146 UTSW 5 21294593 missense possibly damaging 0.56
R3159:Ccdc146 UTSW 5 21399792 missense unknown
R3436:Ccdc146 UTSW 5 21297005 missense possibly damaging 0.92
R4043:Ccdc146 UTSW 5 21316943 missense probably benign 0.14
R4226:Ccdc146 UTSW 5 21322758 missense probably benign 0.09
R4493:Ccdc146 UTSW 5 21303193 missense possibly damaging 0.92
R5013:Ccdc146 UTSW 5 21333038 missense probably damaging 1.00
R5024:Ccdc146 UTSW 5 21399614 splice site probably null
R5051:Ccdc146 UTSW 5 21303083 missense possibly damaging 0.77
R5384:Ccdc146 UTSW 5 21308713 missense probably benign 0.37
R5532:Ccdc146 UTSW 5 21305331 missense probably benign 0.02
R5906:Ccdc146 UTSW 5 21301352 missense possibly damaging 0.88
R5927:Ccdc146 UTSW 5 21308621 nonsense probably null
R5951:Ccdc146 UTSW 5 21319579 missense possibly damaging 0.84
R5978:Ccdc146 UTSW 5 21316968 missense probably benign 0.02
R5990:Ccdc146 UTSW 5 21318182 missense probably benign 0.41
R6123:Ccdc146 UTSW 5 21305597 missense possibly damaging 0.93
R6217:Ccdc146 UTSW 5 21317902 splice site probably null
R6276:Ccdc146 UTSW 5 21301340 missense probably damaging 0.98
R6665:Ccdc146 UTSW 5 21303094 missense probably damaging 1.00
R7077:Ccdc146 UTSW 5 21305274 missense possibly damaging 0.94
R7204:Ccdc146 UTSW 5 21308626 missense probably benign 0.22
R7336:Ccdc146 UTSW 5 21303112 missense probably benign 0.41
R7608:Ccdc146 UTSW 5 21301452 missense probably benign 0.02
R8310:Ccdc146 UTSW 5 21301471 intron probably benign
R8427:Ccdc146 UTSW 5 21399792 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCCATTGTTGTTGACCGTGCC -3'
(R):5'- TTTGCTCGCACCACAACTGACC -3'

Sequencing Primer
(F):5'- TGCCTGGCTCATCAGCAG -3'
(R):5'- AAGATGCTCTTTTAGGACCCAGG -3'
Posted On2014-01-29