Mutagenetix > Incidental Mutation

Incidental Mutation 'R1251:Vmn2r10'

151750

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r10

Ensembl Gene

ENSMUSG00000067010

Gene Name

vomeronasal 2, receptor 10

Synonyms

V2r16, VR16

MMRRC Submission

039318-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R1251 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108993412-109006471 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108996024 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 687 (M687V)

Ref Sequence

ENSEMBL: ENSMUSP00000078162 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079163] [ENSMUST00000176594]

AlphaFold

K7N621

Predicted Effect

probably benign
Transcript: ENSMUST00000079163
AA Change: M687V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000078162
Gene: ENSMUSG00000067010
AA Change: M687V

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	75	464	8.5e-29	PFAM
Pfam:NCD3G	506	560	3.8e-17	PFAM
Pfam:7tm_3	593	828	4e-55	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176594

SMART Domains

Protein: ENSMUSP00000135274
Gene: ENSMUSG00000067010

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Acap2	A	T	16: 31,108,171	Y509N	probably damaging	Het
Adcy9	T	A	16: 4,311,531	E497V	probably damaging	Het
Bcat2	T	G	7: 45,575,986	L56R	probably damaging	Het
Ccdc146	T	C	5: 21,293,372	M952V	probably benign	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Cfap46	C	T	7: 139,601,265	V2607I	probably benign	Het
Clec18a	T	C	8: 111,081,638	I54V	possibly damaging	Het
Coil	A	G	11: 88,982,299	E455G	possibly damaging	Het
Copg1	A	T	6: 87,890,007	K75*	probably null	Het
Cyp2j12	G	A	4: 96,115,666	Q238*	probably null	Het
D17Wsu92e	C	T	17: 27,786,070		probably null	Het
Eif3i	T	C	4: 129,593,385	E229G	probably damaging	Het
Exoc2	T	A	13: 30,886,276	N411Y	probably benign	Het
Eya2	T	A	2: 165,754,484	M305K	probably damaging	Het
Faim	C	T	9: 98,992,634	T78M	probably damaging	Het
Fgg	T	A	3: 83,012,980	D355E	probably benign	Het
Foxn1	A	G	11: 78,358,785	L638P	probably damaging	Het
Grid2ip	A	T	5: 143,386,015	E664D	possibly damaging	Het
Il1rn	A	G	2: 24,345,570	R21G	probably damaging	Het
Inpp4b	G	A	8: 81,890,753	G220R	probably benign	Het
Irx6	A	G	8: 92,678,253	S250G	possibly damaging	Het
Lyst	T	C	13: 13,634,483	I246T	probably benign	Het
Mcm3	G	A	1: 20,812,672	Q353*	probably null	Het
Mfhas1	A	G	8: 35,591,053	Y894C	probably damaging	Het
Mfsd13a	T	C	19: 46,372,053	L348P	probably damaging	Het
Necab1	A	G	4: 15,111,192		probably null	Het
Nectin3	A	T	16: 46,463,842	S160T	possibly damaging	Het
Npc2	A	G	12: 84,760,884	S67P	probably damaging	Het
Olfr1036	G	A	2: 86,074,820	V27M	probably benign	Het
Olfr513	T	G	7: 108,754,907	F17C	probably damaging	Het
Pcnx3	A	G	19: 5,677,182	F1108L	probably benign	Het
Phf21a	G	A	2: 92,359,199	S601N	probably benign	Het
Pold1	C	T	7: 44,535,051	V842I	probably benign	Het
Rabgap1	A	G	2: 37,543,234		probably null	Het
Setd1a	T	A	7: 127,797,424		probably benign	Het
Sgo2a	A	T	1: 57,999,962		probably null	Het
Sult2a8	T	A	7: 14,425,425	K90*	probably null	Het
Tlr2	T	C	3: 83,838,269	D169G	possibly damaging	Het
Tmem95	A	G	11: 69,876,829	F153S	probably benign	Het
Tube1	G	T	10: 39,134,208	G10*	probably null	Het
Zc3h8	G	A	2: 128,935,369	P117S	probably benign	Het
Zeb1	T	A	18: 5,705,089	D18E	probably damaging	Het

Other mutations in Vmn2r10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00816:Vmn2r10	APN	5	109002585	missense	possibly damaging	0.75
IGL01618:Vmn2r10	APN	5	109002479	missense	probably damaging	1.00
IGL01624:Vmn2r10	APN	5	109006246	missense	possibly damaging	0.83
IGL01941:Vmn2r10	APN	5	108995954	missense	probably damaging	1.00
IGL01959:Vmn2r10	APN	5	108997705	missense	probably benign	0.00
IGL01973:Vmn2r10	APN	5	108995677	missense	probably damaging	1.00
IGL01985:Vmn2r10	APN	5	109006259	missense	probably benign	0.21
IGL02451:Vmn2r10	APN	5	108995922	nonsense	probably null
IGL02503:Vmn2r10	APN	5	109003475	missense	probably damaging	1.00
IGL03275:Vmn2r10	APN	5	109003377	missense	probably benign	0.00
R0035:Vmn2r10	UTSW	5	108997601	splice site	probably benign
R0395:Vmn2r10	UTSW	5	109001993	missense	probably damaging	1.00
R0454:Vmn2r10	UTSW	5	109003461	missense	probably benign	0.25
R0648:Vmn2r10	UTSW	5	108995916	missense	probably benign	0.00
R1580:Vmn2r10	UTSW	5	109006251	missense	possibly damaging	0.82
R1845:Vmn2r10	UTSW	5	109001995	nonsense	probably null
R1986:Vmn2r10	UTSW	5	109006254	nonsense	probably null
R2137:Vmn2r10	UTSW	5	109003544	missense	possibly damaging	0.87
R2495:Vmn2r10	UTSW	5	108996095	missense	probably damaging	1.00
R3932:Vmn2r10	UTSW	5	109002222	missense	possibly damaging	0.47
R3933:Vmn2r10	UTSW	5	109002222	missense	possibly damaging	0.47
R4899:Vmn2r10	UTSW	5	109003458	missense	probably damaging	1.00
R4992:Vmn2r10	UTSW	5	108997726	missense	possibly damaging	0.89
R5124:Vmn2r10	UTSW	5	109006420	missense	probably benign	0.01
R5145:Vmn2r10	UTSW	5	108995895	missense	possibly damaging	0.64
R5156:Vmn2r10	UTSW	5	108995600	missense	probably benign	0.11
R5265:Vmn2r10	UTSW	5	108995720	missense	probably damaging	1.00
R5311:Vmn2r10	UTSW	5	109006255	missense	probably damaging	1.00
R5321:Vmn2r10	UTSW	5	108995639	missense	probably damaging	1.00
R5666:Vmn2r10	UTSW	5	108999044	nonsense	probably null
R5670:Vmn2r10	UTSW	5	108999044	nonsense	probably null
R5872:Vmn2r10	UTSW	5	109003511	missense	possibly damaging	0.84
R6004:Vmn2r10	UTSW	5	108999078	missense	probably benign	0.30
R6108:Vmn2r10	UTSW	5	108995801	missense	probably damaging	1.00
R6332:Vmn2r10	UTSW	5	109003462	missense	probably damaging	1.00
R6599:Vmn2r10	UTSW	5	108996078	missense	probably benign	0.09
R6651:Vmn2r10	UTSW	5	108995622	missense	probably null	0.22
R6891:Vmn2r10	UTSW	5	109001979	missense	probably damaging	1.00
R7023:Vmn2r10	UTSW	5	109002028	missense	probably damaging	0.96
R7146:Vmn2r10	UTSW	5	109003334	missense	probably damaging	1.00
R7941:Vmn2r10	UTSW	5	108996440	missense	probably damaging	1.00
R8058:Vmn2r10	UTSW	5	109002089	missense	probably benign	0.00
R8478:Vmn2r10	UTSW	5	108995770	missense	probably damaging	1.00
R8526:Vmn2r10	UTSW	5	108997706	missense	possibly damaging	0.51
R8698:Vmn2r10	UTSW	5	109003524	missense	probably benign	0.00
R8796:Vmn2r10	UTSW	5	108996051	missense	possibly damaging	0.74
R8854:Vmn2r10	UTSW	5	108996260	missense	probably benign	0.20
R8871:Vmn2r10	UTSW	5	108999033	missense	possibly damaging	0.67
R8893:Vmn2r10	UTSW	5	108995811	missense	probably benign	0.09
R8907:Vmn2r10	UTSW	5	109001925	missense	probably benign
R8957:Vmn2r10	UTSW	5	109001914	missense	possibly damaging	0.60
R8976:Vmn2r10	UTSW	5	108997613	missense	probably damaging	1.00
R9155:Vmn2r10	UTSW	5	108996346	missense	probably benign	0.10
R9308:Vmn2r10	UTSW	5	108997610	nonsense	probably null
Z1088:Vmn2r10	UTSW	5	108996113	missense	probably damaging	1.00
Z1176:Vmn2r10	UTSW	5	109001988	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTCCTAGCCAAGAAAGCCACAG -3'
(R):5'- GGCCAATAACCGCATTCTCAGCTAC -3'

Sequencing Primer
(F):5'- GGCACCCAAGTATCCGAG -3'
(R):5'- CGCATTCTCAGCTACATCCTG -3'

Posted On

2014-01-29