Incidental Mutation 'R1251:Vmn2r10'
ID151750
Institutional Source Beutler Lab
Gene Symbol Vmn2r10
Ensembl Gene ENSMUSG00000067010
Gene Namevomeronasal 2, receptor 10
SynonymsV2r16, VR16
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108993412-109006471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108996024 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 687 (M687V)
Ref Sequence ENSEMBL: ENSMUSP00000078162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079163] [ENSMUST00000176594]
Predicted Effect probably benign
Transcript: ENSMUST00000079163
AA Change: M687V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000078162
Gene: ENSMUSG00000067010
AA Change: M687V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 8.5e-29 PFAM
Pfam:NCD3G 506 560 3.8e-17 PFAM
Pfam:7tm_3 593 828 4e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176594
SMART Domains Protein: ENSMUSP00000135274
Gene: ENSMUSG00000067010

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Vmn2r10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Vmn2r10 APN 5 109002585 missense possibly damaging 0.75
IGL01618:Vmn2r10 APN 5 109002479 missense probably damaging 1.00
IGL01624:Vmn2r10 APN 5 109006246 missense possibly damaging 0.83
IGL01941:Vmn2r10 APN 5 108995954 missense probably damaging 1.00
IGL01959:Vmn2r10 APN 5 108997705 missense probably benign 0.00
IGL01973:Vmn2r10 APN 5 108995677 missense probably damaging 1.00
IGL01985:Vmn2r10 APN 5 109006259 missense probably benign 0.21
IGL02451:Vmn2r10 APN 5 108995922 nonsense probably null
IGL02503:Vmn2r10 APN 5 109003475 missense probably damaging 1.00
IGL03275:Vmn2r10 APN 5 109003377 missense probably benign 0.00
R0035:Vmn2r10 UTSW 5 108997601 splice site probably benign
R0395:Vmn2r10 UTSW 5 109001993 missense probably damaging 1.00
R0454:Vmn2r10 UTSW 5 109003461 missense probably benign 0.25
R0648:Vmn2r10 UTSW 5 108995916 missense probably benign 0.00
R1580:Vmn2r10 UTSW 5 109006251 missense possibly damaging 0.82
R1845:Vmn2r10 UTSW 5 109001995 nonsense probably null
R1986:Vmn2r10 UTSW 5 109006254 nonsense probably null
R2137:Vmn2r10 UTSW 5 109003544 missense possibly damaging 0.87
R2495:Vmn2r10 UTSW 5 108996095 missense probably damaging 1.00
R3932:Vmn2r10 UTSW 5 109002222 missense possibly damaging 0.47
R3933:Vmn2r10 UTSW 5 109002222 missense possibly damaging 0.47
R4899:Vmn2r10 UTSW 5 109003458 missense probably damaging 1.00
R4992:Vmn2r10 UTSW 5 108997726 missense possibly damaging 0.89
R5124:Vmn2r10 UTSW 5 109006420 missense probably benign 0.01
R5145:Vmn2r10 UTSW 5 108995895 missense possibly damaging 0.64
R5156:Vmn2r10 UTSW 5 108995600 missense probably benign 0.11
R5265:Vmn2r10 UTSW 5 108995720 missense probably damaging 1.00
R5311:Vmn2r10 UTSW 5 109006255 missense probably damaging 1.00
R5321:Vmn2r10 UTSW 5 108995639 missense probably damaging 1.00
R5666:Vmn2r10 UTSW 5 108999044 nonsense probably null
R5670:Vmn2r10 UTSW 5 108999044 nonsense probably null
R5872:Vmn2r10 UTSW 5 109003511 missense possibly damaging 0.84
R6004:Vmn2r10 UTSW 5 108999078 missense probably benign 0.30
R6108:Vmn2r10 UTSW 5 108995801 missense probably damaging 1.00
R6332:Vmn2r10 UTSW 5 109003462 missense probably damaging 1.00
R6599:Vmn2r10 UTSW 5 108996078 missense probably benign 0.09
R6651:Vmn2r10 UTSW 5 108995622 missense probably null 0.22
R6891:Vmn2r10 UTSW 5 109001979 missense probably damaging 1.00
R7023:Vmn2r10 UTSW 5 109002028 missense probably damaging 0.96
R7146:Vmn2r10 UTSW 5 109003334 missense probably damaging 1.00
R8058:Vmn2r10 UTSW 5 109002089 missense probably benign 0.00
Z1088:Vmn2r10 UTSW 5 108996113 missense probably damaging 1.00
Z1176:Vmn2r10 UTSW 5 109001988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTCCTAGCCAAGAAAGCCACAG -3'
(R):5'- GGCCAATAACCGCATTCTCAGCTAC -3'

Sequencing Primer
(F):5'- GGCACCCAAGTATCCGAG -3'
(R):5'- CGCATTCTCAGCTACATCCTG -3'
Posted On2014-01-29