Mutagenetix > Incidental Mutations

Incidental Mutation 'R1251:Grid2ip'

151751

Institutional Source

Beutler Lab

Gene Symbol

Grid2ip

Ensembl Gene

ENSMUSG00000010825

Gene Name

glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1

Synonyms

delphilin

MMRRC Submission

039318-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.194) question?

Stock #

R1251 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

143357338-143392152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 143386015 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 664 (E664D)

Ref Sequence

ENSEMBL: ENSMUSP00000010969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010969] [ENSMUST00000110733] [ENSMUST00000120825]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000010969
AA Change: E664D

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000010969
Gene: ENSMUSG00000010825
AA Change: E664D

Domain	Start	End	E-Value	Type
low complexity region	30	55	N/A	INTRINSIC
low complexity region	57	73	N/A	INTRINSIC
low complexity region	78	92	N/A	INTRINSIC
PDZ	97	166	9.5e-16	SMART
low complexity region	256	272	N/A	INTRINSIC
low complexity region	284	304	N/A	INTRINSIC
low complexity region	429	446	N/A	INTRINSIC
low complexity region	464	478	N/A	INTRINSIC
low complexity region	536	584	N/A	INTRINSIC
low complexity region	607	625	N/A	INTRINSIC
FH2	633	1022	1.39e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110733
AA Change: E843D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000106361
Gene: ENSMUSG00000010825
AA Change: E843D

Domain	Start	End	E-Value	Type
PDZ	10	80	1.13e-13	SMART
low complexity region	98	109	N/A	INTRINSIC
low complexity region	209	234	N/A	INTRINSIC
low complexity region	236	252	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
PDZ	276	345	9.5e-16	SMART
low complexity region	435	451	N/A	INTRINSIC
low complexity region	463	483	N/A	INTRINSIC
low complexity region	608	625	N/A	INTRINSIC
low complexity region	643	657	N/A	INTRINSIC
low complexity region	715	763	N/A	INTRINSIC
low complexity region	786	804	N/A	INTRINSIC
FH2	812	1201	1.39e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120825
AA Change: E671D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000113443
Gene: ENSMUSG00000010825
AA Change: E671D

Domain	Start	End	E-Value	Type
low complexity region	37	62	N/A	INTRINSIC
low complexity region	64	80	N/A	INTRINSIC
low complexity region	85	99	N/A	INTRINSIC
PDZ	104	173	9.5e-16	SMART
low complexity region	263	279	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
low complexity region	436	453	N/A	INTRINSIC
low complexity region	471	485	N/A	INTRINSIC
low complexity region	543	591	N/A	INTRINSIC
low complexity region	614	632	N/A	INTRINSIC
FH2	640	1029	1.39e-35	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176473

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate receptor delta-2 (GRID2; MIM 602368) is predominantly expressed at parallel fiber-Purkinje cell postsynapses and plays crucial roles in synaptogenesis and synaptic plasticity. GRID2IP1 interacts with GRID2 and may control GRID2 signaling in Purkinje cells (Matsuda et al., 2006 [PubMed 16835239]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display facilitated long-term depression induction at parallel fiber-Purkinje cell synapses as well as enhanced optokinetic response adaptation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Acap2	A	T	16: 31,108,171	Y509N	probably damaging	Het
Adcy9	T	A	16: 4,311,531	E497V	probably damaging	Het
Bcat2	T	G	7: 45,575,986	L56R	probably damaging	Het
Ccdc146	T	C	5: 21,293,372	M952V	probably benign	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Cfap46	C	T	7: 139,601,265	V2607I	probably benign	Het
Clec18a	T	C	8: 111,081,638	I54V	possibly damaging	Het
Coil	A	G	11: 88,982,299	E455G	possibly damaging	Het
Copg1	A	T	6: 87,890,007	K75*	probably null	Het
Cyp2j12	G	A	4: 96,115,666	Q238*	probably null	Het
D17Wsu92e	C	T	17: 27,786,070		probably null	Het
Eif3i	T	C	4: 129,593,385	E229G	probably damaging	Het
Exoc2	T	A	13: 30,886,276	N411Y	probably benign	Het
Eya2	T	A	2: 165,754,484	M305K	probably damaging	Het
Faim	C	T	9: 98,992,634	T78M	probably damaging	Het
Fgg	T	A	3: 83,012,980	D355E	probably benign	Het
Foxn1	A	G	11: 78,358,785	L638P	probably damaging	Het
Il1rn	A	G	2: 24,345,570	R21G	probably damaging	Het
Inpp4b	G	A	8: 81,890,753	G220R	probably benign	Het
Irx6	A	G	8: 92,678,253	S250G	possibly damaging	Het
Lyst	T	C	13: 13,634,483	I246T	probably benign	Het
Mcm3	G	A	1: 20,812,672	Q353*	probably null	Het
Mfhas1	A	G	8: 35,591,053	Y894C	probably damaging	Het
Mfsd13a	T	C	19: 46,372,053	L348P	probably damaging	Het
Necab1	A	G	4: 15,111,192		probably null	Het
Nectin3	A	T	16: 46,463,842	S160T	possibly damaging	Het
Npc2	A	G	12: 84,760,884	S67P	probably damaging	Het
Olfr1036	G	A	2: 86,074,820	V27M	probably benign	Het
Olfr513	T	G	7: 108,754,907	F17C	probably damaging	Het
Pcnx3	A	G	19: 5,677,182	F1108L	probably benign	Het
Phf21a	G	A	2: 92,359,199	S601N	probably benign	Het
Pold1	C	T	7: 44,535,051	V842I	probably benign	Het
Rabgap1	A	G	2: 37,543,234		probably null	Het
Setd1a	T	A	7: 127,797,424		probably benign	Het
Sgo2a	A	T	1: 57,999,962		probably null	Het
Sult2a8	T	A	7: 14,425,425	K90*	probably null	Het
Tlr2	T	C	3: 83,838,269	D169G	possibly damaging	Het
Tmem95	A	G	11: 69,876,829	F153S	probably benign	Het
Tube1	G	T	10: 39,134,208	G10*	probably null	Het
Vmn2r10	T	C	5: 108,996,024	M687V	probably benign	Het
Zc3h8	G	A	2: 128,935,369	P117S	probably benign	Het
Zeb1	T	A	18: 5,705,089	D18E	probably damaging	Het

Other mutations in Grid2ip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02271:Grid2ip	APN	5	143388909	missense	probably benign
IGL02894:Grid2ip	APN	5	143391108	missense	probably benign	0.04
R0024:Grid2ip	UTSW	5	143391041	missense	probably damaging	1.00
R0355:Grid2ip	UTSW	5	143357897	missense	probably benign	0.10
R0403:Grid2ip	UTSW	5	143357620	missense	possibly damaging	0.84
R0523:Grid2ip	UTSW	5	143373043	missense	possibly damaging	0.85
R0605:Grid2ip	UTSW	5	143379362	missense	probably damaging	0.99
R0664:Grid2ip	UTSW	5	143363977	critical splice donor site	probably null
R1116:Grid2ip	UTSW	5	143382914	missense	possibly damaging	0.96
R1381:Grid2ip	UTSW	5	143362651	missense	probably benign	0.00
R1384:Grid2ip	UTSW	5	143386096	critical splice donor site	probably null
R1477:Grid2ip	UTSW	5	143375585	missense	probably damaging	1.00
R2266:Grid2ip	UTSW	5	143386092	missense	probably benign	0.01
R2267:Grid2ip	UTSW	5	143386092	missense	probably benign	0.01
R2304:Grid2ip	UTSW	5	143387840	missense	probably damaging	1.00
R2871:Grid2ip	UTSW	5	143357929	missense	probably benign
R2871:Grid2ip	UTSW	5	143357929	missense	probably benign
R2873:Grid2ip	UTSW	5	143357929	missense	probably benign
R2874:Grid2ip	UTSW	5	143357929	missense	probably benign
R3196:Grid2ip	UTSW	5	143388178	missense	probably damaging	0.99
R3622:Grid2ip	UTSW	5	143386019	missense	probably damaging	1.00
R3930:Grid2ip	UTSW	5	143386039	missense	probably damaging	1.00
R4628:Grid2ip	UTSW	5	143382875	missense	probably damaging	1.00
R4696:Grid2ip	UTSW	5	143391376	intron	probably benign
R4709:Grid2ip	UTSW	5	143388903	missense	probably damaging	1.00
R4772:Grid2ip	UTSW	5	143375700	missense	possibly damaging	0.91
R4838:Grid2ip	UTSW	5	143388775	nonsense	probably null
R4857:Grid2ip	UTSW	5	143382629	missense	probably damaging	1.00
R5243:Grid2ip	UTSW	5	143377505	missense	probably damaging	1.00
R5894:Grid2ip	UTSW	5	143388911	missense	probably damaging	1.00
R6014:Grid2ip	UTSW	5	143387823	missense	possibly damaging	0.84
R6076:Grid2ip	UTSW	5	143387375	missense	probably benign	0.17
R6209:Grid2ip	UTSW	5	143380429	missense	probably damaging	1.00
R6257:Grid2ip	UTSW	5	143380429	missense	probably damaging	1.00
R6274:Grid2ip	UTSW	5	143380429	missense	probably damaging	1.00
R6439:Grid2ip	UTSW	5	143373502	missense	probably damaging	0.99
R7098:Grid2ip	UTSW	5	143357591	missense	probably damaging	0.97
R7405:Grid2ip	UTSW	5	143380444	missense	probably benign	0.03
R7652:Grid2ip	UTSW	5	143382638	missense	probably damaging	1.00
R8259:Grid2ip	UTSW	5	143362589	missense	probably benign	0.20
R8261:Grid2ip	UTSW	5	143381940	critical splice donor site	probably null
R8350:Grid2ip	UTSW	5	143377518	missense	probably damaging	1.00
R8391:Grid2ip	UTSW	5	143380196	missense	probably damaging	0.98
R8450:Grid2ip	UTSW	5	143377518	missense	probably damaging	1.00
R8793:Grid2ip	UTSW	5	143377641	missense	probably damaging	1.00
X0010:Grid2ip	UTSW	5	143357878	missense	probably benign	0.01
X0012:Grid2ip	UTSW	5	143362639	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ACCAGACGGGGAGTCAGTTCTTAG -3'
(R):5'- AGGTCTTGAAGTTTGGAGACACAGTG -3'

Sequencing Primer
(F):5'- cggatgagggtgttggg -3'
(R):5'- GTGTATACTCTGGGAACCGGAA -3'

Posted On

2014-01-29