Incidental Mutation 'R1251:Grid2ip'
ID151751
Institutional Source Beutler Lab
Gene Symbol Grid2ip
Ensembl Gene ENSMUSG00000010825
Gene Nameglutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1
Synonymsdelphilin
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location143357338-143392152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143386015 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 664 (E664D)
Ref Sequence ENSEMBL: ENSMUSP00000010969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010969] [ENSMUST00000110733] [ENSMUST00000120825]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010969
AA Change: E664D

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000010969
Gene: ENSMUSG00000010825
AA Change: E664D

DomainStartEndE-ValueType
low complexity region 30 55 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
PDZ 97 166 9.5e-16 SMART
low complexity region 256 272 N/A INTRINSIC
low complexity region 284 304 N/A INTRINSIC
low complexity region 429 446 N/A INTRINSIC
low complexity region 464 478 N/A INTRINSIC
low complexity region 536 584 N/A INTRINSIC
low complexity region 607 625 N/A INTRINSIC
FH2 633 1022 1.39e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110733
AA Change: E843D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000106361
Gene: ENSMUSG00000010825
AA Change: E843D

DomainStartEndE-ValueType
PDZ 10 80 1.13e-13 SMART
low complexity region 98 109 N/A INTRINSIC
low complexity region 209 234 N/A INTRINSIC
low complexity region 236 252 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
PDZ 276 345 9.5e-16 SMART
low complexity region 435 451 N/A INTRINSIC
low complexity region 463 483 N/A INTRINSIC
low complexity region 608 625 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 715 763 N/A INTRINSIC
low complexity region 786 804 N/A INTRINSIC
FH2 812 1201 1.39e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120825
AA Change: E671D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113443
Gene: ENSMUSG00000010825
AA Change: E671D

DomainStartEndE-ValueType
low complexity region 37 62 N/A INTRINSIC
low complexity region 64 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
PDZ 104 173 9.5e-16 SMART
low complexity region 263 279 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 543 591 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
FH2 640 1029 1.39e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176473
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate receptor delta-2 (GRID2; MIM 602368) is predominantly expressed at parallel fiber-Purkinje cell postsynapses and plays crucial roles in synaptogenesis and synaptic plasticity. GRID2IP1 interacts with GRID2 and may control GRID2 signaling in Purkinje cells (Matsuda et al., 2006 [PubMed 16835239]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display facilitated long-term depression induction at parallel fiber-Purkinje cell synapses as well as enhanced optokinetic response adaptation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Grid2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Grid2ip APN 5 143388909 missense probably benign
IGL02894:Grid2ip APN 5 143391108 missense probably benign 0.04
R0024:Grid2ip UTSW 5 143391041 missense probably damaging 1.00
R0355:Grid2ip UTSW 5 143357897 missense probably benign 0.10
R0403:Grid2ip UTSW 5 143357620 missense possibly damaging 0.84
R0523:Grid2ip UTSW 5 143373043 missense possibly damaging 0.85
R0605:Grid2ip UTSW 5 143379362 missense probably damaging 0.99
R0664:Grid2ip UTSW 5 143363977 critical splice donor site probably null
R1116:Grid2ip UTSW 5 143382914 missense possibly damaging 0.96
R1381:Grid2ip UTSW 5 143362651 missense probably benign 0.00
R1384:Grid2ip UTSW 5 143386096 critical splice donor site probably null
R1477:Grid2ip UTSW 5 143375585 missense probably damaging 1.00
R2266:Grid2ip UTSW 5 143386092 missense probably benign 0.01
R2267:Grid2ip UTSW 5 143386092 missense probably benign 0.01
R2304:Grid2ip UTSW 5 143387840 missense probably damaging 1.00
R2871:Grid2ip UTSW 5 143357929 missense probably benign
R2871:Grid2ip UTSW 5 143357929 missense probably benign
R2873:Grid2ip UTSW 5 143357929 missense probably benign
R2874:Grid2ip UTSW 5 143357929 missense probably benign
R3196:Grid2ip UTSW 5 143388178 missense probably damaging 0.99
R3622:Grid2ip UTSW 5 143386019 missense probably damaging 1.00
R3930:Grid2ip UTSW 5 143386039 missense probably damaging 1.00
R4628:Grid2ip UTSW 5 143382875 missense probably damaging 1.00
R4696:Grid2ip UTSW 5 143391376 intron probably benign
R4709:Grid2ip UTSW 5 143388903 missense probably damaging 1.00
R4772:Grid2ip UTSW 5 143375700 missense possibly damaging 0.91
R4838:Grid2ip UTSW 5 143388775 nonsense probably null
R4857:Grid2ip UTSW 5 143382629 missense probably damaging 1.00
R5243:Grid2ip UTSW 5 143377505 missense probably damaging 1.00
R5894:Grid2ip UTSW 5 143388911 missense probably damaging 1.00
R6014:Grid2ip UTSW 5 143387823 missense possibly damaging 0.84
R6076:Grid2ip UTSW 5 143387375 missense probably benign 0.17
R6209:Grid2ip UTSW 5 143380429 missense probably damaging 1.00
R6257:Grid2ip UTSW 5 143380429 missense probably damaging 1.00
R6274:Grid2ip UTSW 5 143380429 missense probably damaging 1.00
R6439:Grid2ip UTSW 5 143373502 missense probably damaging 0.99
R7098:Grid2ip UTSW 5 143357591 missense probably damaging 0.97
R7405:Grid2ip UTSW 5 143380444 missense probably benign 0.03
R7652:Grid2ip UTSW 5 143382638 missense probably damaging 1.00
R8259:Grid2ip UTSW 5 143362589 missense probably benign 0.20
R8261:Grid2ip UTSW 5 143381940 critical splice donor site probably null
R8350:Grid2ip UTSW 5 143377518 missense probably damaging 1.00
R8391:Grid2ip UTSW 5 143380196 missense probably damaging 0.98
R8450:Grid2ip UTSW 5 143377518 missense probably damaging 1.00
R8793:Grid2ip UTSW 5 143377641 missense probably damaging 1.00
X0010:Grid2ip UTSW 5 143357878 missense probably benign 0.01
X0012:Grid2ip UTSW 5 143362639 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCAGACGGGGAGTCAGTTCTTAG -3'
(R):5'- AGGTCTTGAAGTTTGGAGACACAGTG -3'

Sequencing Primer
(F):5'- cggatgagggtgttggg -3'
(R):5'- GTGTATACTCTGGGAACCGGAA -3'
Posted On2014-01-29