Incidental Mutation 'R1251:Bcat2'
ID151755
Institutional Source Beutler Lab
Gene Symbol Bcat2
Ensembl Gene ENSMUSG00000030826
Gene Namebranched chain aminotransferase 2, mitochondrial
SynonymsEca40, Bcat-2
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45570153-45589711 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 45575986 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 56 (L56R)
Ref Sequence ENSEMBL: ENSMUSP00000147628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033098] [ENSMUST00000120864] [ENSMUST00000209204] [ENSMUST00000210811] [ENSMUST00000211173]
Predicted Effect probably damaging
Transcript: ENSMUST00000033098
AA Change: L96R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033098
Gene: ENSMUSG00000030826
AA Change: L96R

DomainStartEndE-ValueType
Pfam:Aminotran_4 101 351 5.4e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120864
AA Change: L96R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113045
Gene: ENSMUSG00000030826
AA Change: L96R

DomainStartEndE-ValueType
Pfam:Aminotran_4 119 370 7.6e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209204
AA Change: L56R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210623
Predicted Effect probably damaging
Transcript: ENSMUST00000210811
AA Change: L56R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210965
Predicted Effect probably damaging
Transcript: ENSMUST00000211173
AA Change: L56R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211530
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a branched chain aminotransferase found in mitochondria. The encoded protein forms a dimer that catalyzes the first step in the production of the branched chain amino acids leucine, isoleucine, and valine. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: The metabolism of branched chain amino acid is impaired in homozygous null mice, resulting in a phenotype similar to human maple syrup urine disease. Mutants exhibit a failure to thrive and die prematurely, though the severity of the symptoms can be ameliorated with a restricted diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Bcat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Bcat2 APN 7 45588260 missense probably damaging 0.97
IGL02383:Bcat2 APN 7 45588007 missense probably damaging 1.00
IGL03157:Bcat2 APN 7 45575498 missense probably benign
IGL03226:Bcat2 APN 7 45588354 missense probably damaging 1.00
P0022:Bcat2 UTSW 7 45588345 missense probably damaging 1.00
R1940:Bcat2 UTSW 7 45588368 missense possibly damaging 0.76
R5446:Bcat2 UTSW 7 45585145 missense possibly damaging 0.88
R6243:Bcat2 UTSW 7 45588267 missense probably benign 0.19
R6932:Bcat2 UTSW 7 45589321 missense probably damaging 0.98
R7336:Bcat2 UTSW 7 45575485 missense probably benign 0.00
R7434:Bcat2 UTSW 7 45576005 splice site probably null
R7645:Bcat2 UTSW 7 45587963 missense probably benign 0.04
R7732:Bcat2 UTSW 7 45585193 missense possibly damaging 0.65
R7736:Bcat2 UTSW 7 45585193 missense possibly damaging 0.65
R8140:Bcat2 UTSW 7 45588351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGACCTCCAGATTCAGATGACC -3'
(R):5'- AGAACCCCACTCTCTTTCAGAGCAG -3'

Sequencing Primer
(F):5'- TCCAGATTCAGATGACCAAAGAAC -3'
(R):5'- ACTCTCTTTCAGAGCAGAGTCC -3'
Posted On2014-01-29