Incidental Mutation 'R1251:Mfhas1'
ID151760
Institutional Source Beutler Lab
Gene Symbol Mfhas1
Ensembl Gene ENSMUSG00000070056
Gene Namemalignant fibrous histiocytoma amplified sequence 1
Synonyms2310066G09Rik, D8Ertd91e
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location35587798-35679449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35591053 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 894 (Y894C)
Ref Sequence ENSEMBL: ENSMUSP00000044135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037666]
Predicted Effect probably damaging
Transcript: ENSMUST00000037666
AA Change: Y894C

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044135
Gene: ENSMUSG00000070056
AA Change: Y894C

DomainStartEndE-ValueType
LRR 58 81 1.97e1 SMART
LRR 82 105 5.72e-1 SMART
LRR 106 125 2.79e1 SMART
LRR 130 152 8.09e-1 SMART
LRR_TYP 153 175 7.78e-3 SMART
LRR 176 195 5.48e0 SMART
LRR 199 221 6.57e-1 SMART
LRR 222 244 3.98e1 SMART
LRR 245 267 1.25e-1 SMART
LRR 268 290 3.27e1 SMART
LRR 291 313 1.43e-1 SMART
LRR 314 334 1.12e1 SMART
LRR_TYP 337 360 4.11e-2 SMART
Pfam:Roc 407 537 6.9e-11 PFAM
low complexity region 743 750 N/A INTRINSIC
low complexity region 754 761 N/A INTRINSIC
low complexity region 808 820 N/A INTRINSIC
Blast:LY 1018 1038 7e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181322
Predicted Effect unknown
Transcript: ENSMUST00000209953
AA Change: Y699C
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Identified in a human 8p amplicon, this gene is a potential oncogene whose expression is enhanced in some malignant fibrous histiocytomas (MFH). The primary structure of its product includes an ATP/GTP-binding site, three leucine zipper domains, and a leucine-rich tandem repeat, which are structural or functional elements for interactions among proteins related to the cell cycle, and which suggest that overexpression might be oncogenic with respect to MFH. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Mfhas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Mfhas1 APN 8 35590771 missense probably benign 0.00
IGL00841:Mfhas1 APN 8 35590886 missense probably damaging 0.97
IGL01548:Mfhas1 APN 8 35590459 missense probably damaging 1.00
IGL02031:Mfhas1 APN 8 35589372 missense probably damaging 0.99
IGL02093:Mfhas1 APN 8 35589344 missense probably damaging 1.00
IGL02314:Mfhas1 APN 8 35588773 missense probably damaging 0.98
IGL02412:Mfhas1 APN 8 35588815 missense probably benign 0.11
IGL02638:Mfhas1 APN 8 35590950 missense possibly damaging 0.55
IGL02663:Mfhas1 APN 8 35589906 missense probably damaging 0.99
R0545:Mfhas1 UTSW 8 35589048 missense probably damaging 1.00
R0619:Mfhas1 UTSW 8 35590675 missense probably benign 0.00
R0637:Mfhas1 UTSW 8 35590026 nonsense probably null
R1829:Mfhas1 UTSW 8 35590068 missense probably benign
R1829:Mfhas1 UTSW 8 35590248 missense probably benign 0.09
R1839:Mfhas1 UTSW 8 35590858 missense possibly damaging 0.95
R1934:Mfhas1 UTSW 8 35591097 missense possibly damaging 0.52
R1937:Mfhas1 UTSW 8 35589645 missense probably damaging 0.99
R2038:Mfhas1 UTSW 8 35591277 missense probably damaging 1.00
R2982:Mfhas1 UTSW 8 35591115 missense probably benign 0.07
R4566:Mfhas1 UTSW 8 35591049 missense probably damaging 1.00
R4604:Mfhas1 UTSW 8 35588610 missense probably benign 0.00
R4693:Mfhas1 UTSW 8 35589175 missense probably damaging 1.00
R5205:Mfhas1 UTSW 8 35591007 missense probably benign 0.10
R5535:Mfhas1 UTSW 8 35590269 missense possibly damaging 0.73
R5631:Mfhas1 UTSW 8 35588419 missense probably damaging 0.96
R5744:Mfhas1 UTSW 8 35589482 missense probably damaging 1.00
R6580:Mfhas1 UTSW 8 35589265 missense probably damaging 1.00
R6663:Mfhas1 UTSW 8 35589118 missense probably damaging 1.00
R6998:Mfhas1 UTSW 8 35591356 missense probably damaging 1.00
R7046:Mfhas1 UTSW 8 35664790 missense probably benign 0.00
R7054:Mfhas1 UTSW 8 35588638 missense probably benign 0.30
R7171:Mfhas1 UTSW 8 35588992 missense probably benign 0.08
R7396:Mfhas1 UTSW 8 35590199 missense probably damaging 0.97
R7557:Mfhas1 UTSW 8 35589604 missense possibly damaging 0.50
R7853:Mfhas1 UTSW 8 35589871 nonsense probably null
R7876:Mfhas1 UTSW 8 35589543 missense probably damaging 1.00
R8815:Mfhas1 UTSW 8 35590240 missense probably damaging 0.99
X0060:Mfhas1 UTSW 8 35588404 missense possibly damaging 0.52
Z1088:Mfhas1 UTSW 8 35590236 missense probably benign 0.04
Z1177:Mfhas1 UTSW 8 35590385 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTAAGCCTCATGTCCAGGCCCAAC -3'
(R):5'- AGTGTAGTGCAGTCCAGGCCATTC -3'

Sequencing Primer
(F):5'- AAGATGGGACTCTGTTACTGCC -3'
(R):5'- GCCATTCCTGAAGTAGGACATTC -3'
Posted On2014-01-29