Mutagenetix > Incidental Mutation

Incidental Mutation 'R1251:Mfhas1'

151760

Institutional Source

Beutler Lab

Gene Symbol

Mfhas1

Ensembl Gene

ENSMUSG00000070056

Gene Name

malignant fibrous histiocytoma amplified sequence 1

Synonyms

2310066G09Rik, D8Ertd91e

MMRRC Submission

039318-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.175) question?

Stock #

R1251 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

35587798-35679449 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35591053 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 894 (Y894C)

Ref Sequence

ENSEMBL: ENSMUSP00000044135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037666]

AlphaFold

Q3V1N1

Predicted Effect

probably damaging
Transcript: ENSMUST00000037666
AA Change: Y894C

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000044135
Gene: ENSMUSG00000070056
AA Change: Y894C

Domain	Start	End	E-Value	Type
LRR	58	81	1.97e1	SMART
LRR	82	105	5.72e-1	SMART
LRR	106	125	2.79e1	SMART
LRR	130	152	8.09e-1	SMART
LRR_TYP	153	175	7.78e-3	SMART
LRR	176	195	5.48e0	SMART
LRR	199	221	6.57e-1	SMART
LRR	222	244	3.98e1	SMART
LRR	245	267	1.25e-1	SMART
LRR	268	290	3.27e1	SMART
LRR	291	313	1.43e-1	SMART
LRR	314	334	1.12e1	SMART
LRR_TYP	337	360	4.11e-2	SMART
Pfam:Roc	407	537	6.9e-11	PFAM
low complexity region	743	750	N/A	INTRINSIC
low complexity region	754	761	N/A	INTRINSIC
low complexity region	808	820	N/A	INTRINSIC
Blast:LY	1018	1038	7e-6	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181322

Predicted Effect

unknown
Transcript: ENSMUST00000209953
AA Change: Y699C

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Identified in a human 8p amplicon, this gene is a potential oncogene whose expression is enhanced in some malignant fibrous histiocytomas (MFH). The primary structure of its product includes an ATP/GTP-binding site, three leucine zipper domains, and a leucine-rich tandem repeat, which are structural or functional elements for interactions among proteins related to the cell cycle, and which suggest that overexpression might be oncogenic with respect to MFH. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Acap2	A	T	16: 31,108,171	Y509N	probably damaging	Het
Adcy9	T	A	16: 4,311,531	E497V	probably damaging	Het
Bcat2	T	G	7: 45,575,986	L56R	probably damaging	Het
Ccdc146	T	C	5: 21,293,372	M952V	probably benign	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Cfap46	C	T	7: 139,601,265	V2607I	probably benign	Het
Clec18a	T	C	8: 111,081,638	I54V	possibly damaging	Het
Coil	A	G	11: 88,982,299	E455G	possibly damaging	Het
Copg1	A	T	6: 87,890,007	K75*	probably null	Het
Cyp2j12	G	A	4: 96,115,666	Q238*	probably null	Het
D17Wsu92e	C	T	17: 27,786,070		probably null	Het
Eif3i	T	C	4: 129,593,385	E229G	probably damaging	Het
Exoc2	T	A	13: 30,886,276	N411Y	probably benign	Het
Eya2	T	A	2: 165,754,484	M305K	probably damaging	Het
Faim	C	T	9: 98,992,634	T78M	probably damaging	Het
Fgg	T	A	3: 83,012,980	D355E	probably benign	Het
Foxn1	A	G	11: 78,358,785	L638P	probably damaging	Het
Grid2ip	A	T	5: 143,386,015	E664D	possibly damaging	Het
Il1rn	A	G	2: 24,345,570	R21G	probably damaging	Het
Inpp4b	G	A	8: 81,890,753	G220R	probably benign	Het
Irx6	A	G	8: 92,678,253	S250G	possibly damaging	Het
Lyst	T	C	13: 13,634,483	I246T	probably benign	Het
Mcm3	G	A	1: 20,812,672	Q353*	probably null	Het
Mfsd13a	T	C	19: 46,372,053	L348P	probably damaging	Het
Necab1	A	G	4: 15,111,192		probably null	Het
Nectin3	A	T	16: 46,463,842	S160T	possibly damaging	Het
Npc2	A	G	12: 84,760,884	S67P	probably damaging	Het
Olfr1036	G	A	2: 86,074,820	V27M	probably benign	Het
Olfr513	T	G	7: 108,754,907	F17C	probably damaging	Het
Pcnx3	A	G	19: 5,677,182	F1108L	probably benign	Het
Phf21a	G	A	2: 92,359,199	S601N	probably benign	Het
Pold1	C	T	7: 44,535,051	V842I	probably benign	Het
Rabgap1	A	G	2: 37,543,234		probably null	Het
Setd1a	T	A	7: 127,797,424		probably benign	Het
Sgo2a	A	T	1: 57,999,962		probably null	Het
Sult2a8	T	A	7: 14,425,425	K90*	probably null	Het
Tlr2	T	C	3: 83,838,269	D169G	possibly damaging	Het
Tmem95	A	G	11: 69,876,829	F153S	probably benign	Het
Tube1	G	T	10: 39,134,208	G10*	probably null	Het
Vmn2r10	T	C	5: 108,996,024	M687V	probably benign	Het
Zc3h8	G	A	2: 128,935,369	P117S	probably benign	Het
Zeb1	T	A	18: 5,705,089	D18E	probably damaging	Het

Other mutations in Mfhas1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00694:Mfhas1	APN	8	35590771	missense	probably benign	0.00
IGL00841:Mfhas1	APN	8	35590886	missense	probably damaging	0.97
IGL01548:Mfhas1	APN	8	35590459	missense	probably damaging	1.00
IGL02031:Mfhas1	APN	8	35589372	missense	probably damaging	0.99
IGL02093:Mfhas1	APN	8	35589344	missense	probably damaging	1.00
IGL02314:Mfhas1	APN	8	35588773	missense	probably damaging	0.98
IGL02412:Mfhas1	APN	8	35588815	missense	probably benign	0.11
IGL02638:Mfhas1	APN	8	35590950	missense	possibly damaging	0.55
IGL02663:Mfhas1	APN	8	35589906	missense	probably damaging	0.99
R0545:Mfhas1	UTSW	8	35589048	missense	probably damaging	1.00
R0619:Mfhas1	UTSW	8	35590675	missense	probably benign	0.00
R0637:Mfhas1	UTSW	8	35590026	nonsense	probably null
R1829:Mfhas1	UTSW	8	35590068	missense	probably benign
R1829:Mfhas1	UTSW	8	35590248	missense	probably benign	0.09
R1839:Mfhas1	UTSW	8	35590858	missense	possibly damaging	0.95
R1934:Mfhas1	UTSW	8	35591097	missense	possibly damaging	0.52
R1937:Mfhas1	UTSW	8	35589645	missense	probably damaging	0.99
R2038:Mfhas1	UTSW	8	35591277	missense	probably damaging	1.00
R2982:Mfhas1	UTSW	8	35591115	missense	probably benign	0.07
R4566:Mfhas1	UTSW	8	35591049	missense	probably damaging	1.00
R4604:Mfhas1	UTSW	8	35588610	missense	probably benign	0.00
R4693:Mfhas1	UTSW	8	35589175	missense	probably damaging	1.00
R5205:Mfhas1	UTSW	8	35591007	missense	probably benign	0.10
R5535:Mfhas1	UTSW	8	35590269	missense	possibly damaging	0.73
R5631:Mfhas1	UTSW	8	35588419	missense	probably damaging	0.96
R5744:Mfhas1	UTSW	8	35589482	missense	probably damaging	1.00
R6580:Mfhas1	UTSW	8	35589265	missense	probably damaging	1.00
R6663:Mfhas1	UTSW	8	35589118	missense	probably damaging	1.00
R6998:Mfhas1	UTSW	8	35591356	missense	probably damaging	1.00
R7046:Mfhas1	UTSW	8	35664790	missense	probably benign	0.00
R7054:Mfhas1	UTSW	8	35588638	missense	probably benign	0.30
R7171:Mfhas1	UTSW	8	35588992	missense	probably benign	0.08
R7396:Mfhas1	UTSW	8	35590199	missense	probably damaging	0.97
R7557:Mfhas1	UTSW	8	35589604	missense	possibly damaging	0.50
R7853:Mfhas1	UTSW	8	35589871	nonsense	probably null
R7876:Mfhas1	UTSW	8	35589543	missense	probably damaging	1.00
R8815:Mfhas1	UTSW	8	35590240	missense	probably damaging	0.99
R9009:Mfhas1	UTSW	8	35589955	missense	probably damaging	1.00
R9214:Mfhas1	UTSW	8	35590576	missense	probably damaging	1.00
R9281:Mfhas1	UTSW	8	35590797	missense	probably benign	0.01
X0060:Mfhas1	UTSW	8	35588404	missense	possibly damaging	0.52
Z1088:Mfhas1	UTSW	8	35590236	missense	probably benign	0.04
Z1177:Mfhas1	UTSW	8	35590385	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TTAAGCCTCATGTCCAGGCCCAAC -3'
(R):5'- AGTGTAGTGCAGTCCAGGCCATTC -3'

Sequencing Primer
(F):5'- AAGATGGGACTCTGTTACTGCC -3'
(R):5'- GCCATTCCTGAAGTAGGACATTC -3'

Posted On

2014-01-29