Incidental Mutation 'R1251:Irx6'
ID151762
Institutional Source Beutler Lab
Gene Symbol Irx6
Ensembl Gene ENSMUSG00000031738
Gene NameIroquois homeobox 6
Synonyms
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location92674288-92680956 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92678253 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 250 (S250G)
Ref Sequence ENSEMBL: ENSMUSP00000127446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034185] [ENSMUST00000167261]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034185
AA Change: S250G

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034185
Gene: ENSMUSG00000031738
AA Change: S250G

DomainStartEndE-ValueType
low complexity region 19 24 N/A INTRINSIC
low complexity region 38 46 N/A INTRINSIC
HOX 143 208 1.76e-13 SMART
coiled coil region 247 280 N/A INTRINSIC
IRO 338 355 9e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167261
AA Change: S250G

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127446
Gene: ENSMUSG00000031738
AA Change: S250G

DomainStartEndE-ValueType
low complexity region 19 24 N/A INTRINSIC
low complexity region 38 46 N/A INTRINSIC
HOX 143 208 1.76e-13 SMART
coiled coil region 247 280 N/A INTRINSIC
IRO 338 355 9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210252
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display abnormalities in retinal bipolar cell subtype identity and reduced electroretinography a and b wave amplitudes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Irx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Irx6 APN 8 92676089 nonsense probably null
IGL02308:Irx6 APN 8 92677031 missense probably damaging 1.00
R0308:Irx6 UTSW 8 92677031 missense probably damaging 1.00
R1191:Irx6 UTSW 8 92676952 missense probably damaging 1.00
R4161:Irx6 UTSW 8 92676291 missense possibly damaging 0.78
R4368:Irx6 UTSW 8 92678401 missense probably damaging 1.00
R4924:Irx6 UTSW 8 92678353 missense probably benign 0.25
R4950:Irx6 UTSW 8 92678800 missense probably damaging 1.00
R5425:Irx6 UTSW 8 92677517 critical splice donor site probably null
R6455:Irx6 UTSW 8 92676072 missense probably benign 0.04
R6969:Irx6 UTSW 8 92677330 missense probably damaging 1.00
R7019:Irx6 UTSW 8 92678734 missense probably damaging 0.99
R7128:Irx6 UTSW 8 92677366 missense probably damaging 1.00
R7133:Irx6 UTSW 8 92678413 missense probably damaging 1.00
R8182:Irx6 UTSW 8 92677014 nonsense probably null
R8546:Irx6 UTSW 8 92678636 missense probably benign 0.19
Z1176:Irx6 UTSW 8 92678371 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGCAGTGCAAAGTAACCTTCCCTTG -3'
(R):5'- TGCTGTGATGAAGTCAGCTTCCC -3'

Sequencing Primer
(F):5'- ACAGACAGCCTTGGAGCTTG -3'
(R):5'- ATGAAGTCAGCTTCCCCTGATTG -3'
Posted On2014-01-29