Incidental Mutation 'R1251:Clec18a'
ID151763
Institutional Source Beutler Lab
Gene Symbol Clec18a
Ensembl Gene ENSMUSG00000033633
Gene NameC-type lectin domain family 18, member A
SynonymsMrcl
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R1251 (G1)
Quality Score215
Status Not validated
Chromosome8
Chromosomal Location111058920-111092426 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111081638 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 54 (I54V)
Ref Sequence ENSEMBL: ENSMUSP00000139789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039597] [ENSMUST00000186384] [ENSMUST00000188466] [ENSMUST00000190222] [ENSMUST00000190778] [ENSMUST00000191030] [ENSMUST00000191469]
Predicted Effect probably benign
Transcript: ENSMUST00000039597
AA Change: D44G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046546
Gene: ENSMUSG00000033633
AA Change: D44G

DomainStartEndE-ValueType
low complexity region 85 96 N/A INTRINSIC
SCP 130 278 5.76e-19 SMART
EGF 312 349 5.32e-1 SMART
EGF_like 351 380 4.83e1 SMART
CLECT 385 521 4.65e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186384
AA Change: D44G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000188466
AA Change: I23V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000141073
Gene: ENSMUSG00000033633
AA Change: I23V

DomainStartEndE-ValueType
signal peptide 1 53 N/A INTRINSIC
SCP 69 217 2.8e-21 SMART
EGF 251 288 2.6e-3 SMART
EGF_like 290 319 2.4e-1 SMART
CLECT 324 460 2.3e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190222
AA Change: I23V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000139634
Gene: ENSMUSG00000033633
AA Change: I23V

DomainStartEndE-ValueType
signal peptide 1 53 N/A INTRINSIC
SCP 69 217 2.8e-21 SMART
EGF 251 288 2.6e-3 SMART
EGF_like 290 319 2.4e-1 SMART
Pfam:Lectin_C 343 418 1.7e-4 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190778
AA Change: I54V

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139789
Gene: ENSMUSG00000033633
AA Change: I54V

DomainStartEndE-ValueType
low complexity region 59 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191030
AA Change: I54V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000139569
Gene: ENSMUSG00000033633
AA Change: I54V

DomainStartEndE-ValueType
low complexity region 59 80 N/A INTRINSIC
SCP 100 248 5.76e-19 SMART
EGF 282 319 5.32e-1 SMART
EGF_like 321 350 4.83e1 SMART
CLECT 355 491 4.65e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191469
AA Change: D44G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139515
Gene: ENSMUSG00000033633
AA Change: D44G

DomainStartEndE-ValueType
low complexity region 85 96 N/A INTRINSIC
SCP 130 278 5.76e-19 SMART
EGF 312 349 5.32e-1 SMART
EGF_like 351 380 4.83e1 SMART
CLECT 385 521 4.65e-20 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Clec18a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Clec18a APN 8 111071613 missense probably damaging 1.00
LCD18:Clec18a UTSW 8 111076136 splice site probably benign
R1528:Clec18a UTSW 8 111078866 missense probably benign 0.00
R1994:Clec18a UTSW 8 111081602 missense possibly damaging 0.90
R2283:Clec18a UTSW 8 111075508 missense probably benign 0.33
R4458:Clec18a UTSW 8 111075470 missense probably damaging 1.00
R4790:Clec18a UTSW 8 111072085 missense probably damaging 1.00
R5249:Clec18a UTSW 8 111073736 missense probably damaging 1.00
R5848:Clec18a UTSW 8 111075461 missense probably benign 0.24
R5862:Clec18a UTSW 8 111081558 missense possibly damaging 0.46
R6052:Clec18a UTSW 8 111078816 nonsense probably null
R6361:Clec18a UTSW 8 111081029 intron probably benign
R6786:Clec18a UTSW 8 111080940 missense probably benign 0.00
R7220:Clec18a UTSW 8 111081572 missense probably benign 0.00
R8074:Clec18a UTSW 8 111071598 missense probably damaging 0.99
R8157:Clec18a UTSW 8 111072051 missense probably damaging 1.00
R8170:Clec18a UTSW 8 111080919 missense probably damaging 0.98
R8309:Clec18a UTSW 8 111082057 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCTCACAACAGCATCTCTACTTCCG -3'
(R):5'- CCTACAATGATTAGCAGGGGCCAC -3'

Sequencing Primer
(F):5'- CGTCTTTGCCCAGGTGTTC -3'
(R):5'- CGTTTAGAAGAAGGGTTCTATGTCTC -3'
Posted On2014-01-29