Incidental Mutation 'R1251:Abcb10'
ID 151764
Institutional Source Beutler Lab
Gene Symbol Abcb10
Ensembl Gene ENSMUSG00000031974
Gene Name ATP-binding cassette, sub-family B (MDR/TAP), member 10
Synonyms ABC-me
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1251 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 123952459-123983122 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 123962052 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 495 (G495D)
Ref Sequence ENSEMBL: ENSMUSP00000075011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075578] [ENSMUST00000127664]
AlphaFold Q9JI39
Predicted Effect probably damaging
Transcript: ENSMUST00000075578
AA Change: G495D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075011
Gene: ENSMUSG00000031974
AA Change: G495D

DomainStartEndE-ValueType
Pfam:ABC_membrane 136 407 1.7e-60 PFAM
AAA 484 675 1.68e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212356
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ATP-binding cassette superfamily of transporters. ATP-binding cassette proteins transport various molecules across extra- and intra-cellular membranes. The encoded protein is localized to the mitochondrial inner membrane where it interacts with and stabilizes mitoferrin-1, and is important for heme biosynthesis. Additional evidence suggests the encoded protein is involved in oxidative stress protection and erythropoisesis. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for this allele exhibit increased response to ischemia and reperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Abcb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02219:Abcb10 APN 8 123954427 missense probably benign 0.00
IGL02279:Abcb10 APN 8 123954361 missense probably benign 0.17
IGL02302:Abcb10 APN 8 123958672 missense possibly damaging 0.89
IGL02342:Abcb10 APN 8 123962034 missense probably damaging 1.00
IGL03062:Abcb10 APN 8 123954315 missense possibly damaging 0.49
IGL03409:Abcb10 APN 8 123965023 missense possibly damaging 0.63
R0320:Abcb10 UTSW 8 123963007 missense probably benign 0.00
R0436:Abcb10 UTSW 8 123971001 missense probably benign 0.01
R1074:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1224:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1225:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1226:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1252:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1254:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1255:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1256:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1355:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1370:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1424:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1499:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1769:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R2096:Abcb10 UTSW 8 123982456 missense probably benign 0.01
R2125:Abcb10 UTSW 8 123965092 missense probably benign 0.29
R2274:Abcb10 UTSW 8 123982752 missense probably benign 0.23
R4801:Abcb10 UTSW 8 123966527 missense probably benign 0.12
R4802:Abcb10 UTSW 8 123966527 missense probably benign 0.12
R4850:Abcb10 UTSW 8 123982690 missense probably benign 0.01
R5320:Abcb10 UTSW 8 123971024 missense probably benign 0.11
R5947:Abcb10 UTSW 8 123967998 splice site probably null
R6006:Abcb10 UTSW 8 123968065 missense probably benign 0.00
R6328:Abcb10 UTSW 8 123962017 missense probably damaging 1.00
R7168:Abcb10 UTSW 8 123966611 missense
R8130:Abcb10 UTSW 8 123965018 missense
R8131:Abcb10 UTSW 8 123965018 missense
R8132:Abcb10 UTSW 8 123965018 missense
R8431:Abcb10 UTSW 8 123968134 missense
R9111:Abcb10 UTSW 8 123969907 missense
R9258:Abcb10 UTSW 8 123982608 missense probably benign
R9423:Abcb10 UTSW 8 123962080 missense
V7581:Abcb10 UTSW 8 123969761 intron probably benign
Z1176:Abcb10 UTSW 8 123982663 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGCACATGTCAGCAGAGTTCCAG -3'
(R):5'- ACTTCAGTCAGGCAAGGGAGACAC -3'

Sequencing Primer
(F):5'- CTGACCCATTTCCAAGGGTAG -3'
(R):5'- GGCATTCTGCCCTGAGC -3'
Posted On 2014-01-29