Mutagenetix > Incidental Mutations

Incidental Mutation 'R1251:Abcb10'

151764

Institutional Source

Beutler Lab

Gene Symbol

Abcb10

Ensembl Gene

ENSMUSG00000031974

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 10

Synonyms

ABC-me

MMRRC Submission

039318-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1251 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123952459-123983122 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 123962052 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 495 (G495D)

Ref Sequence

ENSEMBL: ENSMUSP00000075011 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075578] [ENSMUST00000127664]

Predicted Effect

probably damaging
Transcript: ENSMUST00000075578
AA Change: G495D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000075011
Gene: ENSMUSG00000031974
AA Change: G495D

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	136	407	1.7e-60	PFAM
AAA	484	675	1.68e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212188

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212250

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212356

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the ATP-binding cassette superfamily of transporters. ATP-binding cassette proteins transport various molecules across extra- and intra-cellular membranes. The encoded protein is localized to the mitochondrial inner membrane where it interacts with and stabilizes mitoferrin-1, and is important for heme biosynthesis. Additional evidence suggests the encoded protein is involved in oxidative stress protection and erythropoisesis. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for this allele exhibit increased response to ischemia and reperfusion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap2	A	T	16: 31,108,171	Y509N	probably damaging	Het
Adcy9	T	A	16: 4,311,531	E497V	probably damaging	Het
Bcat2	T	G	7: 45,575,986	L56R	probably damaging	Het
Ccdc146	T	C	5: 21,293,372	M952V	probably benign	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Cfap46	C	T	7: 139,601,265	V2607I	probably benign	Het
Clec18a	T	C	8: 111,081,638	I54V	possibly damaging	Het
Coil	A	G	11: 88,982,299	E455G	possibly damaging	Het
Copg1	A	T	6: 87,890,007	K75*	probably null	Het
Cyp2j12	G	A	4: 96,115,666	Q238*	probably null	Het
D17Wsu92e	C	T	17: 27,786,070		probably null	Het
Eif3i	T	C	4: 129,593,385	E229G	probably damaging	Het
Exoc2	T	A	13: 30,886,276	N411Y	probably benign	Het
Eya2	T	A	2: 165,754,484	M305K	probably damaging	Het
Faim	C	T	9: 98,992,634	T78M	probably damaging	Het
Fgg	T	A	3: 83,012,980	D355E	probably benign	Het
Foxn1	A	G	11: 78,358,785	L638P	probably damaging	Het
Grid2ip	A	T	5: 143,386,015	E664D	possibly damaging	Het
Il1rn	A	G	2: 24,345,570	R21G	probably damaging	Het
Inpp4b	G	A	8: 81,890,753	G220R	probably benign	Het
Irx6	A	G	8: 92,678,253	S250G	possibly damaging	Het
Lyst	T	C	13: 13,634,483	I246T	probably benign	Het
Mcm3	G	A	1: 20,812,672	Q353*	probably null	Het
Mfhas1	A	G	8: 35,591,053	Y894C	probably damaging	Het
Mfsd13a	T	C	19: 46,372,053	L348P	probably damaging	Het
Necab1	A	G	4: 15,111,192		probably null	Het
Nectin3	A	T	16: 46,463,842	S160T	possibly damaging	Het
Npc2	A	G	12: 84,760,884	S67P	probably damaging	Het
Olfr1036	G	A	2: 86,074,820	V27M	probably benign	Het
Olfr513	T	G	7: 108,754,907	F17C	probably damaging	Het
Pcnx3	A	G	19: 5,677,182	F1108L	probably benign	Het
Phf21a	G	A	2: 92,359,199	S601N	probably benign	Het
Pold1	C	T	7: 44,535,051	V842I	probably benign	Het
Rabgap1	A	G	2: 37,543,234		probably null	Het
Setd1a	T	A	7: 127,797,424		probably benign	Het
Sgo2a	A	T	1: 57,999,962		probably null	Het
Sult2a8	T	A	7: 14,425,425	K90*	probably null	Het
Tlr2	T	C	3: 83,838,269	D169G	possibly damaging	Het
Tmem95	A	G	11: 69,876,829	F153S	probably benign	Het
Tube1	G	T	10: 39,134,208	G10*	probably null	Het
Vmn2r10	T	C	5: 108,996,024	M687V	probably benign	Het
Zc3h8	G	A	2: 128,935,369	P117S	probably benign	Het
Zeb1	T	A	18: 5,705,089	D18E	probably damaging	Het

Other mutations in Abcb10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02219:Abcb10	APN	8	123954427	missense	probably benign	0.00
IGL02279:Abcb10	APN	8	123954361	missense	probably benign	0.17
IGL02302:Abcb10	APN	8	123958672	missense	possibly damaging	0.89
IGL02342:Abcb10	APN	8	123962034	missense	probably damaging	1.00
IGL03062:Abcb10	APN	8	123954315	missense	possibly damaging	0.49
IGL03409:Abcb10	APN	8	123965023	missense	possibly damaging	0.63
R0320:Abcb10	UTSW	8	123963007	missense	probably benign	0.00
R0436:Abcb10	UTSW	8	123971001	missense	probably benign	0.01
R1074:Abcb10	UTSW	8	123962052	missense	probably damaging	1.00
R1224:Abcb10	UTSW	8	123962052	missense	probably damaging	1.00
R1225:Abcb10	UTSW	8	123962052	missense	probably damaging	1.00
R1226:Abcb10	UTSW	8	123962052	missense	probably damaging	1.00
R1252:Abcb10	UTSW	8	123962052	missense	probably damaging	1.00
R1254:Abcb10	UTSW	8	123962052	missense	probably damaging	1.00
R1255:Abcb10	UTSW	8	123962052	missense	probably damaging	1.00
R1256:Abcb10	UTSW	8	123962052	missense	probably damaging	1.00
R1355:Abcb10	UTSW	8	123962052	missense	probably damaging	1.00
R1370:Abcb10	UTSW	8	123962052	missense	probably damaging	1.00
R1424:Abcb10	UTSW	8	123962052	missense	probably damaging	1.00
R1499:Abcb10	UTSW	8	123962052	missense	probably damaging	1.00
R1769:Abcb10	UTSW	8	123962052	missense	probably damaging	1.00
R2096:Abcb10	UTSW	8	123982456	missense	probably benign	0.01
R2125:Abcb10	UTSW	8	123965092	missense	probably benign	0.29
R2274:Abcb10	UTSW	8	123982752	missense	probably benign	0.23
R4801:Abcb10	UTSW	8	123966527	missense	probably benign	0.12
R4802:Abcb10	UTSW	8	123966527	missense	probably benign	0.12
R4850:Abcb10	UTSW	8	123982690	missense	probably benign	0.01
R5320:Abcb10	UTSW	8	123971024	missense	probably benign	0.11
R5947:Abcb10	UTSW	8	123967998	splice site	probably null
R6006:Abcb10	UTSW	8	123968065	missense	probably benign	0.00
R6328:Abcb10	UTSW	8	123962017	missense	probably damaging	1.00
R7168:Abcb10	UTSW	8	123966611	missense
R8130:Abcb10	UTSW	8	123965018	missense
R8131:Abcb10	UTSW	8	123965018	missense
R8132:Abcb10	UTSW	8	123965018	missense
R8431:Abcb10	UTSW	8	123968134	missense
V7581:Abcb10	UTSW	8	123969761	intron	probably benign
Z1176:Abcb10	UTSW	8	123982663	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- AGCACATGTCAGCAGAGTTCCAG -3'
(R):5'- ACTTCAGTCAGGCAAGGGAGACAC -3'

Sequencing Primer
(F):5'- CTGACCCATTTCCAAGGGTAG -3'
(R):5'- GGCATTCTGCCCTGAGC -3'

Posted On

2014-01-29