Incidental Mutation 'R1251:Faim'
ID151765
Institutional Source Beutler Lab
Gene Symbol Faim
Ensembl Gene ENSMUSG00000032463
Gene NameFas apoptotic inhibitory molecule
SynonymsFaim-L, Faim-S
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location98986373-99002021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98992634 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 78 (T78M)
Ref Sequence ENSEMBL: ENSMUSP00000140627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035038] [ENSMUST00000112911] [ENSMUST00000185472]
Predicted Effect probably damaging
Transcript: ENSMUST00000035038
AA Change: T78M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035038
Gene: ENSMUSG00000032463
AA Change: T78M

DomainStartEndE-ValueType
Pfam:FAIM1 1 177 3e-98 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112911
AA Change: T100M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108532
Gene: ENSMUSG00000032463
AA Change: T100M

DomainStartEndE-ValueType
Pfam:FAIM1 25 197 9.8e-90 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185472
AA Change: T78M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140627
Gene: ENSMUSG00000032463
AA Change: T78M

DomainStartEndE-ValueType
Pfam:FAIM1 1 175 1.8e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187211
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene protects against death receptor-triggered apoptosis and regulates B-cell signaling and differentiation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a null allele have thymocytes with an enhanced susceptibility to FAS-induced apoptosis, and B cells that more susceptible to activation induced cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Faim
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Faim APN 9 98992165 missense probably damaging 1.00
IGL00783:Faim APN 9 98992165 missense probably damaging 1.00
IGL00784:Faim APN 9 98992165 missense probably damaging 1.00
IGL00785:Faim APN 9 98992165 missense probably damaging 1.00
IGL00786:Faim APN 9 98992165 missense probably damaging 1.00
IGL00809:Faim APN 9 98992165 missense probably damaging 1.00
IGL00811:Faim APN 9 98992165 missense probably damaging 1.00
IGL00813:Faim APN 9 98992165 missense probably damaging 1.00
IGL00814:Faim APN 9 98992165 missense probably damaging 1.00
IGL00815:Faim APN 9 98992165 missense probably damaging 1.00
IGL00816:Faim APN 9 98992165 missense probably damaging 1.00
IGL00817:Faim APN 9 98992165 missense probably damaging 1.00
IGL00821:Faim APN 9 98992165 missense probably damaging 1.00
IGL01330:Faim APN 9 98992535 missense probably damaging 1.00
IGL01925:Faim APN 9 98990919 unclassified probably benign
IGL02703:Faim APN 9 98992201 missense probably benign 0.09
R0638:Faim UTSW 9 98992096 splice site probably benign
R5476:Faim UTSW 9 98992729 missense probably damaging 1.00
R5901:Faim UTSW 9 98992142 missense probably benign 0.01
R6250:Faim UTSW 9 98992123 start codon destroyed probably benign 0.15
R7282:Faim UTSW 9 98992126 missense probably benign
R8034:Faim UTSW 9 98992733 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATGACTACCCTGGGAAACCTGGAC -3'
(R):5'- GATATCACAATGGCCGGAAGGCTC -3'

Sequencing Primer
(F):5'- AGTACTGCCATTAGAACACTCTG -3'
(R):5'- GGTCTTTGACCTGTTCTCCA -3'
Posted On2014-01-29