Incidental Mutation 'R1251:Tube1'
ID151766
Institutional Source Beutler Lab
Gene Symbol Tube1
Ensembl Gene ENSMUSG00000019845
Gene Nameepsilon-tubulin 1
Synonyms
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location39133976-39152542 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 39134208 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 10 (G10*)
Ref Sequence ENSEMBL: ENSMUSP00000150602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019991] [ENSMUST00000063204] [ENSMUST00000124941] [ENSMUST00000125042] [ENSMUST00000134279] [ENSMUST00000135785] [ENSMUST00000139743] [ENSMUST00000149949] [ENSMUST00000213459]
Predicted Effect probably null
Transcript: ENSMUST00000019991
AA Change: G10*
SMART Domains Protein: ENSMUSP00000019991
Gene: ENSMUSG00000019845
AA Change: G10*

DomainStartEndE-ValueType
Tubulin 55 277 1.08e-38 SMART
Tubulin_C 279 414 9.81e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063204
SMART Domains Protein: ENSMUSP00000063508
Gene: ENSMUSG00000051736

DomainStartEndE-ValueType
Pfam:UPF0731 2 80 4.8e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124941
SMART Domains Protein: ENSMUSP00000123540
Gene: ENSMUSG00000051736

DomainStartEndE-ValueType
Pfam:UPF0731 2 80 4.8e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125042
SMART Domains Protein: ENSMUSP00000121708
Gene: ENSMUSG00000051736

DomainStartEndE-ValueType
Pfam:UPF0731 2 48 3.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134279
SMART Domains Protein: ENSMUSP00000118858
Gene: ENSMUSG00000051736

DomainStartEndE-ValueType
Pfam:UPF0731 2 80 4.8e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135785
SMART Domains Protein: ENSMUSP00000118928
Gene: ENSMUSG00000051736

DomainStartEndE-ValueType
Pfam:UPF0731 2 80 4.8e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139743
SMART Domains Protein: ENSMUSP00000118545
Gene: ENSMUSG00000051736

DomainStartEndE-ValueType
Pfam:UPF0731 3 80 4.6e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149949
SMART Domains Protein: ENSMUSP00000121946
Gene: ENSMUSG00000051736

DomainStartEndE-ValueType
Pfam:UPF0731 2 80 4.8e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213237
Predicted Effect probably null
Transcript: ENSMUST00000213459
AA Change: G10*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217214
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubulin superfamily. This protein localizes to the centriolar sub-distal appendages that are associated with the older of the two centrioles after centrosome duplication. This protein plays a central role in organization of the microtubules during centriole duplication. A pseudogene of this gene is found on chromosome 5.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Tube1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Tube1 APN 10 39145722 splice site probably benign
IGL01977:Tube1 APN 10 39135045 splice site probably benign
IGL02437:Tube1 APN 10 39140850 missense probably damaging 1.00
IGL03251:Tube1 APN 10 39134981 splice site probably benign
R0145:Tube1 UTSW 10 39145602 missense possibly damaging 0.89
R0544:Tube1 UTSW 10 39140945 splice site probably null
R0834:Tube1 UTSW 10 39134172 splice site probably null
R1557:Tube1 UTSW 10 39145715 critical splice donor site probably null
R1607:Tube1 UTSW 10 39144766 missense possibly damaging 0.89
R2138:Tube1 UTSW 10 39147351 missense probably benign 0.04
R2367:Tube1 UTSW 10 39144919 missense probably damaging 1.00
R4209:Tube1 UTSW 10 39144934 splice site probably null
R4646:Tube1 UTSW 10 39142367 missense possibly damaging 0.63
R4840:Tube1 UTSW 10 39144846 missense probably benign 0.06
R5267:Tube1 UTSW 10 39144556 missense probably benign 0.00
R6331:Tube1 UTSW 10 39134101 missense probably benign 0.01
R7602:Tube1 UTSW 10 39142266 missense probably benign 0.33
R7778:Tube1 UTSW 10 39142298 missense probably benign 0.25
R7824:Tube1 UTSW 10 39142298 missense probably benign 0.25
R8218:Tube1 UTSW 10 39147379 missense possibly damaging 0.78
R8412:Tube1 UTSW 10 39145661 missense possibly damaging 0.95
X0023:Tube1 UTSW 10 39144762 missense probably benign 0.00
Z1177:Tube1 UTSW 10 39149457 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACAAGGGCATTACGACATTGGCTAC -3'
(R):5'- CCTTCTGCCTGTGACTTACAGCAAC -3'

Sequencing Primer
(F):5'- ACGACATTGGCTACTTGCG -3'
(R):5'- cacagcaagtcccaggtcag -3'
Posted On2014-01-29