Incidental Mutation 'R1251:Foxn1'
ID151768
Institutional Source Beutler Lab
Gene Symbol Foxn1
Ensembl Gene ENSMUSG00000002057
Gene Nameforkhead box N1
Synonymswhn, D11Bhm185e, Hfh11
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1251 (G1)
Quality Score120
Status Not validated
Chromosome11
Chromosomal Location78357577-78386558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78358785 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 638 (L638P)
Ref Sequence ENSEMBL: ENSMUSP00000103929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108294]
Predicted Effect probably damaging
Transcript: ENSMUST00000108294
AA Change: L638P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103929
Gene: ENSMUSG00000002057
AA Change: L638P

DomainStartEndE-ValueType
FH 269 361 2.43e-45 SMART
low complexity region 392 409 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 558 586 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the forkhead family or "winged-helix" transcription factors that are important in developmental processes, immune system regulation, metabolism, cancer and aging. This gene family has over 100 members, subdivided into classes (A-Q) based on phylogeny. The encoded protein is proposed to regulate development of the thymus and differentiation of keratinocytes. Mutations in this gene cause severe primary T-cell immunodeficiency and congenital alopecia. In mouse mutations of this gene underlie the phenotype of the nude mouse, which has been widely used as a model system in oncology, immunology, dermatology, and transplantation studies. In humans mutations in this gene have been correlated with T-cell immunodeficiency, the skin disorder congenital alopecia, and nail dystrophy. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygotes for different mutations have in genetically determined absence or loss of hair and failed hair keratinization, premature lethality (differing by genetic background) and absence of thymus, resulting in multiple immune abnormalities. Heterozygotes have enlarged thymuses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Foxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Foxn1 APN 11 78371283 missense probably benign 0.24
IGL01391:Foxn1 APN 11 78361494 missense probably damaging 1.00
IGL01737:Foxn1 APN 11 78360906 missense possibly damaging 0.81
IGL02669:Foxn1 APN 11 78371160 missense probably damaging 0.99
IGL03276:Foxn1 APN 11 78371124 missense probably benign 0.16
R0200:Foxn1 UTSW 11 78361040 missense probably damaging 1.00
R0639:Foxn1 UTSW 11 78371144 missense possibly damaging 0.67
R0739:Foxn1 UTSW 11 78358999 missense probably benign 0.01
R1112:Foxn1 UTSW 11 78371030 missense probably benign 0.29
R1167:Foxn1 UTSW 11 78359066 missense probably damaging 0.99
R1474:Foxn1 UTSW 11 78361107 missense probably benign
R1506:Foxn1 UTSW 11 78365935 splice site probably benign
R1616:Foxn1 UTSW 11 78358866 missense probably benign 0.00
R1795:Foxn1 UTSW 11 78371225 missense probably benign 0.01
R1905:Foxn1 UTSW 11 78371810 splice site probably null
R1906:Foxn1 UTSW 11 78371810 splice site probably null
R1975:Foxn1 UTSW 11 78365937 splice site probably benign
R1976:Foxn1 UTSW 11 78365937 splice site probably benign
R2206:Foxn1 UTSW 11 78358804 missense probably benign 0.02
R2207:Foxn1 UTSW 11 78358804 missense probably benign 0.02
R2988:Foxn1 UTSW 11 78358777 missense possibly damaging 0.74
R2989:Foxn1 UTSW 11 78358777 missense possibly damaging 0.74
R5015:Foxn1 UTSW 11 78371163 missense probably damaging 1.00
R5140:Foxn1 UTSW 11 78361633 missense probably benign 0.18
R5533:Foxn1 UTSW 11 78365966 missense probably damaging 1.00
R6712:Foxn1 UTSW 11 78361259 missense probably damaging 1.00
R6852:Foxn1 UTSW 11 78360960 missense probably benign 0.00
R7176:Foxn1 UTSW 11 78360867 missense possibly damaging 0.94
R7331:Foxn1 UTSW 11 78358789 missense probably damaging 1.00
R7515:Foxn1 UTSW 11 78371144 missense possibly damaging 0.67
R7562:Foxn1 UTSW 11 78371132 missense probably damaging 1.00
R7657:Foxn1 UTSW 11 78365964 missense probably benign 0.29
X0067:Foxn1 UTSW 11 78361542 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATGATGAGCAGGTGTGTAGAGC -3'
(R):5'- TCCCAGAGTGGATGCCAAGATAGG -3'

Sequencing Primer
(F):5'- CACCAGGTAGCATCCTAGATGG -3'
(R):5'- GACAGACTGGGCTTAACTCTCTATG -3'
Posted On2014-01-29