Incidental Mutation 'R1251:Coil'
ID151769
Institutional Source Beutler Lab
Gene Symbol Coil
Ensembl Gene ENSMUSG00000033983
Gene Namecoilin
SynonymsCln80, p80-coilin
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location88970252-88991613 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88982299 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 455 (E455G)
Ref Sequence ENSEMBL: ENSMUSP00000103530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036649] [ENSMUST00000107898]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036649
AA Change: E455G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047588
Gene: ENSMUSG00000033983
AA Change: E455G

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
low complexity region 161 167 N/A INTRINSIC
low complexity region 174 195 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 401 417 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107898
AA Change: E455G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103530
Gene: ENSMUSG00000033983
AA Change: E455G

DomainStartEndE-ValueType
Pfam:Coilin_N 10 220 8.7e-35 PFAM
low complexity region 303 325 N/A INTRINSIC
low complexity region 404 420 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral component of Cajal bodies (also called coiled bodies). Cajal bodies are nuclear suborganelles of varying number and composition that are involved in the post-transcriptional modification of small nuclear and small nucleolar RNAs. The N-terminus of the coilin protein directs its self-oligomerization while the C-terminus influences the number of nuclear bodies assembled per cell. Differential methylation and phosphorylation of coilin likely influences its localization among nuclear bodies and the composition and assembly of Cajal bodies. This gene has pseudogenes on chromosome 4 and chromosome 14. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation in this gene show reduced viability on inbred backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acap2 A T 16: 31,108,171 Y509N probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Coil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02238:Coil APN 11 88981754 missense probably benign 0.02
PIT4519001:Coil UTSW 11 88972726 start gained probably benign
PIT4520001:Coil UTSW 11 88981611 missense probably benign 0.01
R0122:Coil UTSW 11 88985007 splice site probably benign
R0211:Coil UTSW 11 88982153 missense probably damaging 1.00
R0288:Coil UTSW 11 88981868 missense probably damaging 1.00
R0396:Coil UTSW 11 88981623 missense probably benign
R0416:Coil UTSW 11 88981986 missense possibly damaging 0.55
R1481:Coil UTSW 11 88974060 missense possibly damaging 0.87
R1705:Coil UTSW 11 88974136 missense probably damaging 1.00
R1728:Coil UTSW 11 88973976 missense probably damaging 0.98
R1824:Coil UTSW 11 88982097 missense possibly damaging 0.91
R2989:Coil UTSW 11 88987979 missense probably damaging 1.00
R3819:Coil UTSW 11 88981793 missense probably benign 0.07
R5217:Coil UTSW 11 88981161 missense possibly damaging 0.94
R6997:Coil UTSW 11 88981847 missense probably benign
R7050:Coil UTSW 11 88981188 missense possibly damaging 0.87
R8504:Coil UTSW 11 88981154 nonsense probably null
RF007:Coil UTSW 11 88981830 small deletion probably benign
Z1176:Coil UTSW 11 88981976 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTCTTAAAGCCAACTGGCCTC -3'
(R):5'- ACCATGACTCCTGACAATTGCAGAC -3'

Sequencing Primer
(F):5'- TGGAAGTCTTCTGACTCAAACCG -3'
(R):5'- ATTCACTAAGGAAGCTGGGG -3'
Posted On2014-01-29