Incidental Mutation 'R1251:Acap2'
ID151776
Institutional Source Beutler Lab
Gene Symbol Acap2
Ensembl Gene ENSMUSG00000049076
Gene NameArfGAP with coiled-coil, ankyrin repeat and PH domains 2
SynonymsCentb2, 9530039J15Rik
MMRRC Submission 039318-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R1251 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location31092412-31201245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31108171 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 509 (Y509N)
Ref Sequence ENSEMBL: ENSMUSP00000154852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058033] [ENSMUST00000229010] [ENSMUST00000230614] [ENSMUST00000230698] [ENSMUST00000231125]
Predicted Effect probably damaging
Transcript: ENSMUST00000058033
AA Change: Y484N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061501
Gene: ENSMUSG00000049076
AA Change: Y484N

DomainStartEndE-ValueType
Pfam:BAR_3 5 238 9.1e-96 PFAM
PH 267 363 1.73e-17 SMART
ArfGap 399 520 2.23e-63 SMART
ANK 632 661 6.71e-2 SMART
ANK 665 694 3.04e0 SMART
ANK 698 727 6.64e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229010
AA Change: Y502N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000230614
AA Change: Y502N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230698
Predicted Effect probably damaging
Transcript: ENSMUST00000231125
AA Change: Y509N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Adcy9 T A 16: 4,311,531 E497V probably damaging Het
Bcat2 T G 7: 45,575,986 L56R probably damaging Het
Ccdc146 T C 5: 21,293,372 M952V probably benign Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cfap46 C T 7: 139,601,265 V2607I probably benign Het
Clec18a T C 8: 111,081,638 I54V possibly damaging Het
Coil A G 11: 88,982,299 E455G possibly damaging Het
Copg1 A T 6: 87,890,007 K75* probably null Het
Cyp2j12 G A 4: 96,115,666 Q238* probably null Het
D17Wsu92e C T 17: 27,786,070 probably null Het
Eif3i T C 4: 129,593,385 E229G probably damaging Het
Exoc2 T A 13: 30,886,276 N411Y probably benign Het
Eya2 T A 2: 165,754,484 M305K probably damaging Het
Faim C T 9: 98,992,634 T78M probably damaging Het
Fgg T A 3: 83,012,980 D355E probably benign Het
Foxn1 A G 11: 78,358,785 L638P probably damaging Het
Grid2ip A T 5: 143,386,015 E664D possibly damaging Het
Il1rn A G 2: 24,345,570 R21G probably damaging Het
Inpp4b G A 8: 81,890,753 G220R probably benign Het
Irx6 A G 8: 92,678,253 S250G possibly damaging Het
Lyst T C 13: 13,634,483 I246T probably benign Het
Mcm3 G A 1: 20,812,672 Q353* probably null Het
Mfhas1 A G 8: 35,591,053 Y894C probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Necab1 A G 4: 15,111,192 probably null Het
Nectin3 A T 16: 46,463,842 S160T possibly damaging Het
Npc2 A G 12: 84,760,884 S67P probably damaging Het
Olfr1036 G A 2: 86,074,820 V27M probably benign Het
Olfr513 T G 7: 108,754,907 F17C probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Phf21a G A 2: 92,359,199 S601N probably benign Het
Pold1 C T 7: 44,535,051 V842I probably benign Het
Rabgap1 A G 2: 37,543,234 probably null Het
Setd1a T A 7: 127,797,424 probably benign Het
Sgo2a A T 1: 57,999,962 probably null Het
Sult2a8 T A 7: 14,425,425 K90* probably null Het
Tlr2 T C 3: 83,838,269 D169G possibly damaging Het
Tmem95 A G 11: 69,876,829 F153S probably benign Het
Tube1 G T 10: 39,134,208 G10* probably null Het
Vmn2r10 T C 5: 108,996,024 M687V probably benign Het
Zc3h8 G A 2: 128,935,369 P117S probably benign Het
Zeb1 T A 18: 5,705,089 D18E probably damaging Het
Other mutations in Acap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Acap2 APN 16 31139475 missense probably damaging 1.00
IGL01330:Acap2 APN 16 31154677 missense probably damaging 1.00
IGL01420:Acap2 APN 16 31101819 splice site probably benign
IGL02064:Acap2 APN 16 31127328 missense probably damaging 1.00
IGL02173:Acap2 APN 16 31108147 missense possibly damaging 0.68
IGL02453:Acap2 APN 16 31131257 splice site probably null
IGL02883:Acap2 APN 16 31096345 unclassified probably benign
IGL03203:Acap2 APN 16 31096345 unclassified probably benign
IGL03342:Acap2 APN 16 31105492 missense probably damaging 1.00
R1377:Acap2 UTSW 16 31116051 missense probably damaging 1.00
R1432:Acap2 UTSW 16 31111083 missense probably damaging 1.00
R1546:Acap2 UTSW 16 31104936 nonsense probably null
R1594:Acap2 UTSW 16 31127387 missense probably benign 0.01
R1829:Acap2 UTSW 16 31110934 missense probably damaging 1.00
R1853:Acap2 UTSW 16 31117304 missense probably damaging 1.00
R1970:Acap2 UTSW 16 31133527 critical splice donor site probably null
R2023:Acap2 UTSW 16 31119415 missense probably damaging 0.99
R2086:Acap2 UTSW 16 31110945 missense probably damaging 1.00
R2145:Acap2 UTSW 16 31105524 missense probably benign
R2177:Acap2 UTSW 16 31133528 critical splice donor site probably null
R2214:Acap2 UTSW 16 31108128 missense probably benign 0.19
R2392:Acap2 UTSW 16 31139640 missense probably damaging 0.99
R2438:Acap2 UTSW 16 31117315 missense probably damaging 1.00
R2913:Acap2 UTSW 16 31116069 missense probably damaging 0.99
R4207:Acap2 UTSW 16 31119427 missense probably damaging 0.99
R4274:Acap2 UTSW 16 31108114 missense probably benign 0.01
R4814:Acap2 UTSW 16 31108126 missense probably benign
R4860:Acap2 UTSW 16 31103499 missense possibly damaging 0.92
R4860:Acap2 UTSW 16 31103499 missense possibly damaging 0.92
R5310:Acap2 UTSW 16 31133609 missense probably benign 0.00
R5345:Acap2 UTSW 16 31108126 missense probably benign
R5388:Acap2 UTSW 16 31109725 missense probably damaging 1.00
R5551:Acap2 UTSW 16 31104908 missense probably damaging 1.00
R5578:Acap2 UTSW 16 31108114 missense probably benign 0.00
R6341:Acap2 UTSW 16 31105546 missense possibly damaging 0.86
R6659:Acap2 UTSW 16 31131315 missense probably damaging 0.99
R6977:Acap2 UTSW 16 31117261 missense probably damaging 1.00
R7262:Acap2 UTSW 16 31127319 critical splice donor site probably null
R7304:Acap2 UTSW 16 31108116 missense probably benign 0.05
R7310:Acap2 UTSW 16 31108154 nonsense probably null
R7318:Acap2 UTSW 16 31127337 missense probably damaging 1.00
R7514:Acap2 UTSW 16 31154567 splice site probably null
R7875:Acap2 UTSW 16 31139641 missense probably damaging 0.99
R8256:Acap2 UTSW 16 31139469 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATACCTGGGGTGTGGACAGATGC -3'
(R):5'- GTCACGGAGTGCCATGTAACTGAG -3'

Sequencing Primer
(F):5'- ACAGATGCTCTGGCATGG -3'
(R):5'- ACAAGAGGGTGTTCAATTCCCTG -3'
Posted On2014-01-29