Incidental Mutation 'R1252:Slc23a2'
ID151789
Institutional Source Beutler Lab
Gene Symbol Slc23a2
Ensembl Gene ENSMUSG00000027340
Gene Namesolute carrier family 23 (nucleobase transporters), member 2
SynonymsSlc23a1, SVCT2, YSPL3
MMRRC Submission 039319-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1252 (G1)
Quality Score98
Status Not validated
Chromosome2
Chromosomal Location132052496-132145108 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 132062197 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028815]
Predicted Effect probably null
Transcript: ENSMUST00000028815
SMART Domains Protein: ENSMUSP00000028815
Gene: ENSMUSG00000027340

DomainStartEndE-ValueType
Pfam:Xan_ur_permease 101 534 1.7e-93 PFAM
transmembrane domain 547 566 N/A INTRINSIC
low complexity region 578 592 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137910
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The absorption of vitamin C into the body and its distribution to organs requires two sodium-dependent vitamin C transporters. This gene encodes one of the two required transporters and the encoded protein accounts for tissue-specific uptake of vitamin C. Previously, this gene had an official symbol of SLC23A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within minutes of birth from respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsm2 C T 7: 119,573,245 H104Y probably benign Het
Adgrb3 G A 1: 25,128,828 T1009M probably damaging Het
Arfgef2 A G 2: 166,859,957 K755E probably damaging Het
Atm A T 9: 53,455,840 D2491E probably damaging Het
Bptf A G 11: 107,073,251 S1706P probably benign Het
Capn13 C T 17: 73,367,227 G77D possibly damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cep135 A G 5: 76,594,115 K133E possibly damaging Het
Cyp2c67 A G 19: 39,626,141 M314T possibly damaging Het
Dennd5b T C 6: 149,044,487 D542G probably damaging Het
Dpys A T 15: 39,824,240 N387K probably damaging Het
Erc1 A T 6: 119,743,392 D749E possibly damaging Het
Gm281 T C 14: 13,862,444 D370G probably benign Het
Gucy2e A T 11: 69,235,659 F298L probably benign Het
Igsf10 A G 3: 59,331,848 V304A probably benign Het
Kmt2b A T 7: 30,580,487 C1363S probably damaging Het
Krt83 A G 15: 101,487,830 Y295H probably damaging Het
Lmo7 T C 14: 101,900,583 V396A probably damaging Het
Lpl A G 8: 68,892,659 D105G probably benign Het
Lrrc45 C A 11: 120,715,471 T135N probably benign Het
Ltn1 C T 16: 87,416,030 A548T probably benign Het
Nectin2 T G 7: 19,717,598 I504L probably benign Het
Nmbr T C 10: 14,760,443 I52T probably benign Het
Nop14 A T 5: 34,650,555 N354K probably benign Het
Olfm1 A G 2: 28,229,435 I361V probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Ovol1 T C 19: 5,553,601 T91A probably benign Het
Pigz T A 16: 31,941,990 V3E possibly damaging Het
Pip4k2b T C 11: 97,744,594 N4S probably benign Het
Pqlc1 A G 18: 80,291,598 T211A possibly damaging Het
Speg A T 1: 75,427,095 D2640V probably damaging Het
Trip12 G A 1: 84,776,350 Q111* probably null Het
Trub2 A G 2: 29,782,158 F141S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdfy4 A T 14: 32,971,772 probably null Het
Zfp935 A G 13: 62,454,541 F282L probably damaging Het
Zfp946 G T 17: 22,453,579 probably null Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Other mutations in Slc23a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc23a2 APN 2 132101500 missense probably benign 0.00
IGL01123:Slc23a2 APN 2 132056816 missense probably benign 0.02
IGL03115:Slc23a2 APN 2 132091265 missense probably damaging 1.00
R0352:Slc23a2 UTSW 2 132060796 missense probably benign 0.03
R0446:Slc23a2 UTSW 2 132078433 missense probably benign 0.06
R0499:Slc23a2 UTSW 2 132072017 missense probably damaging 1.00
R1663:Slc23a2 UTSW 2 132065464 missense probably damaging 1.00
R1768:Slc23a2 UTSW 2 132075641 missense probably benign
R1914:Slc23a2 UTSW 2 132056766 missense probably damaging 0.99
R2277:Slc23a2 UTSW 2 132091259 missense possibly damaging 0.54
R2326:Slc23a2 UTSW 2 132094195 missense possibly damaging 0.72
R2385:Slc23a2 UTSW 2 132089201 missense probably benign 0.01
R4049:Slc23a2 UTSW 2 132060683 missense probably benign 0.00
R4084:Slc23a2 UTSW 2 132091217 nonsense probably null
R4497:Slc23a2 UTSW 2 132056782 nonsense probably null
R4710:Slc23a2 UTSW 2 132056709 missense probably benign
R4873:Slc23a2 UTSW 2 132056880 missense possibly damaging 0.75
R4875:Slc23a2 UTSW 2 132056880 missense possibly damaging 0.75
R5008:Slc23a2 UTSW 2 132101494 missense probably damaging 0.99
R5164:Slc23a2 UTSW 2 132075450 intron probably benign
R5236:Slc23a2 UTSW 2 132075584 missense probably damaging 0.97
R6587:Slc23a2 UTSW 2 132078481 missense possibly damaging 0.70
R6738:Slc23a2 UTSW 2 132078436 missense probably benign 0.10
R6960:Slc23a2 UTSW 2 132091253 missense probably damaging 1.00
R7000:Slc23a2 UTSW 2 132094203 missense possibly damaging 0.93
R7062:Slc23a2 UTSW 2 132091269 missense probably damaging 0.99
R7293:Slc23a2 UTSW 2 132089106 missense probably benign 0.02
R7324:Slc23a2 UTSW 2 132089123 missense probably damaging 1.00
R8077:Slc23a2 UTSW 2 132089172 missense possibly damaging 0.51
R8794:Slc23a2 UTSW 2 132060709 missense probably benign 0.01
X0011:Slc23a2 UTSW 2 132091263 missense possibly damaging 0.64
X0018:Slc23a2 UTSW 2 132066806 missense probably benign 0.30
Z1176:Slc23a2 UTSW 2 132060788 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGGTCTGAAGACTGAAGCCTGTGT -3'
(R):5'- CAGAGGGCATCTTGGGTTGTCTCTA -3'

Sequencing Primer
(F):5'- AGTGTCTGCCAACCTGAAG -3'
(R):5'- ACTGCTATATTTGCGCTGGG -3'
Posted On2014-01-29