Incidental Mutation 'R1252:Arfgef2'
ID151790
Institutional Source Beutler Lab
Gene Symbol Arfgef2
Ensembl Gene ENSMUSG00000074582
Gene NameADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
SynonymsE230011G24Rik, BIG2
MMRRC Submission 039319-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R1252 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location166805588-166898052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 166859957 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 755 (K755E)
Ref Sequence ENSEMBL: ENSMUSP00000096677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099078]
Predicted Effect probably damaging
Transcript: ENSMUST00000099078
AA Change: K755E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096677
Gene: ENSMUSG00000074582
AA Change: K755E

DomainStartEndE-ValueType
Pfam:DCB 7 200 1.6e-40 PFAM
Pfam:Sec7_N 377 536 3.7e-53 PFAM
Blast:Sec7 549 598 8e-18 BLAST
low complexity region 621 633 N/A INTRINSIC
Sec7 647 834 1.55e-97 SMART
Blast:Sec7 853 888 2e-11 BLAST
Blast:Sec7 902 941 4e-15 BLAST
low complexity region 1044 1055 N/A INTRINSIC
Pfam:DUF1981 1174 1257 6e-38 PFAM
low complexity region 1719 1729 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP and is involved in Golgi transport. It contains a Sec7 domain, which may be responsible for its guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exencephaly, midline gut closure defects, periventricular and subependymal heterotopia, and impaired neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsm2 C T 7: 119,573,245 H104Y probably benign Het
Adgrb3 G A 1: 25,128,828 T1009M probably damaging Het
Atm A T 9: 53,455,840 D2491E probably damaging Het
Bptf A G 11: 107,073,251 S1706P probably benign Het
Capn13 C T 17: 73,367,227 G77D possibly damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cep135 A G 5: 76,594,115 K133E possibly damaging Het
Cyp2c67 A G 19: 39,626,141 M314T possibly damaging Het
Dennd5b T C 6: 149,044,487 D542G probably damaging Het
Dpys A T 15: 39,824,240 N387K probably damaging Het
Erc1 A T 6: 119,743,392 D749E possibly damaging Het
Gm281 T C 14: 13,862,444 D370G probably benign Het
Gucy2e A T 11: 69,235,659 F298L probably benign Het
Igsf10 A G 3: 59,331,848 V304A probably benign Het
Kmt2b A T 7: 30,580,487 C1363S probably damaging Het
Krt83 A G 15: 101,487,830 Y295H probably damaging Het
Lmo7 T C 14: 101,900,583 V396A probably damaging Het
Lpl A G 8: 68,892,659 D105G probably benign Het
Lrrc45 C A 11: 120,715,471 T135N probably benign Het
Ltn1 C T 16: 87,416,030 A548T probably benign Het
Nectin2 T G 7: 19,717,598 I504L probably benign Het
Nmbr T C 10: 14,760,443 I52T probably benign Het
Nop14 A T 5: 34,650,555 N354K probably benign Het
Olfm1 A G 2: 28,229,435 I361V probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Ovol1 T C 19: 5,553,601 T91A probably benign Het
Pigz T A 16: 31,941,990 V3E possibly damaging Het
Pip4k2b T C 11: 97,744,594 N4S probably benign Het
Pqlc1 A G 18: 80,291,598 T211A possibly damaging Het
Slc23a2 A T 2: 132,062,197 probably null Het
Speg A T 1: 75,427,095 D2640V probably damaging Het
Trip12 G A 1: 84,776,350 Q111* probably null Het
Trub2 A G 2: 29,782,158 F141S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdfy4 A T 14: 32,971,772 probably null Het
Zfp935 A G 13: 62,454,541 F282L probably damaging Het
Zfp946 G T 17: 22,453,579 probably null Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Other mutations in Arfgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Arfgef2 APN 2 166885853 missense probably damaging 1.00
IGL01323:Arfgef2 APN 2 166871495 missense probably damaging 1.00
IGL01415:Arfgef2 APN 2 166867355 missense probably damaging 0.98
IGL01638:Arfgef2 APN 2 166873945 missense probably damaging 0.97
IGL02618:Arfgef2 APN 2 166853313 missense probably damaging 1.00
IGL02899:Arfgef2 APN 2 166869051 splice site probably benign
IGL03012:Arfgef2 APN 2 166868888 splice site probably benign
IGL03063:Arfgef2 APN 2 166859782 splice site probably benign
shimmering UTSW 2 166826928 missense probably benign
R0102:Arfgef2 UTSW 2 166845465 missense probably benign 0.00
R0102:Arfgef2 UTSW 2 166845465 missense probably benign 0.00
R0116:Arfgef2 UTSW 2 166873683 missense probably damaging 1.00
R0128:Arfgef2 UTSW 2 166835719 missense probably damaging 1.00
R0130:Arfgef2 UTSW 2 166835719 missense probably damaging 1.00
R0208:Arfgef2 UTSW 2 166867422 missense probably damaging 1.00
R0379:Arfgef2 UTSW 2 166860400 critical splice donor site probably null
R0945:Arfgef2 UTSW 2 166826969 unclassified probably benign
R1226:Arfgef2 UTSW 2 166827640 missense probably damaging 1.00
R1695:Arfgef2 UTSW 2 166864712 missense probably damaging 0.98
R1696:Arfgef2 UTSW 2 166861638 missense probably damaging 1.00
R1742:Arfgef2 UTSW 2 166866980 missense probably damaging 1.00
R1935:Arfgef2 UTSW 2 166863603 missense probably benign 0.28
R1936:Arfgef2 UTSW 2 166863603 missense probably benign 0.28
R1939:Arfgef2 UTSW 2 166873628 missense probably damaging 1.00
R2276:Arfgef2 UTSW 2 166865759 missense probably benign 0.00
R2279:Arfgef2 UTSW 2 166865759 missense probably benign 0.00
R2349:Arfgef2 UTSW 2 166852028 missense probably damaging 1.00
R2359:Arfgef2 UTSW 2 166860619 missense probably damaging 1.00
R2414:Arfgef2 UTSW 2 166845504 missense probably benign 0.00
R2519:Arfgef2 UTSW 2 166881244 missense probably benign 0.03
R2938:Arfgef2 UTSW 2 166894733 missense probably damaging 1.00
R3696:Arfgef2 UTSW 2 166853300 nonsense probably null
R4022:Arfgef2 UTSW 2 166873945 missense probably benign 0.01
R4227:Arfgef2 UTSW 2 166867324 missense probably damaging 1.00
R4293:Arfgef2 UTSW 2 166890291 missense probably benign
R4455:Arfgef2 UTSW 2 166894715 missense probably benign 0.43
R4499:Arfgef2 UTSW 2 166885814 missense probably damaging 0.99
R4570:Arfgef2 UTSW 2 166856538 missense probably damaging 0.99
R4888:Arfgef2 UTSW 2 166835613 missense probably damaging 1.00
R4893:Arfgef2 UTSW 2 166866956 missense probably benign
R5032:Arfgef2 UTSW 2 166878544 missense probably benign
R5191:Arfgef2 UTSW 2 166876511 missense probably damaging 1.00
R5200:Arfgef2 UTSW 2 166860684 missense probably benign 0.00
R5318:Arfgef2 UTSW 2 166873971 missense probably damaging 1.00
R5378:Arfgef2 UTSW 2 166873628 missense probably damaging 1.00
R5537:Arfgef2 UTSW 2 166856593 splice site probably null
R5866:Arfgef2 UTSW 2 166836257 missense possibly damaging 0.88
R5878:Arfgef2 UTSW 2 166870217 missense probably benign 0.41
R5972:Arfgef2 UTSW 2 166891836 missense probably damaging 1.00
R6147:Arfgef2 UTSW 2 166871495 missense probably damaging 1.00
R6293:Arfgef2 UTSW 2 166873588 missense possibly damaging 0.92
R6323:Arfgef2 UTSW 2 166834484 missense probably damaging 1.00
R6338:Arfgef2 UTSW 2 166845570 missense probably damaging 1.00
R6538:Arfgef2 UTSW 2 166893621 splice site probably null
R6726:Arfgef2 UTSW 2 166893620 critical splice donor site probably null
R7047:Arfgef2 UTSW 2 166851945 splice site probably null
R7086:Arfgef2 UTSW 2 166876616 missense probably damaging 1.00
R7108:Arfgef2 UTSW 2 166873608 missense possibly damaging 0.80
R7155:Arfgef2 UTSW 2 166865813 missense probably benign 0.19
R7159:Arfgef2 UTSW 2 166826928 missense probably benign
R7482:Arfgef2 UTSW 2 166851279 critical splice donor site probably null
R7598:Arfgef2 UTSW 2 166856524 missense probably benign
R7869:Arfgef2 UTSW 2 166873703 missense probably damaging 1.00
R7952:Arfgef2 UTSW 2 166873703 missense probably damaging 1.00
R8003:Arfgef2 UTSW 2 166853288 missense not run
X0040:Arfgef2 UTSW 2 166859883 missense probably damaging 1.00
X0063:Arfgef2 UTSW 2 166891841 missense probably benign 0.32
Z1088:Arfgef2 UTSW 2 166893595 missense possibly damaging 0.78
Z1176:Arfgef2 UTSW 2 166894712 missense not run
Predicted Primers PCR Primer
(F):5'- CTGGGAGACAGCACGAGGTTTAAC -3'
(R):5'- TGAACGGTATGATGCAGAGCCAC -3'

Sequencing Primer
(F):5'- TTTAACAAGGAGGTGATGTATGCC -3'
(R):5'- GCCACGGAAGTCTTCTGAAC -3'
Posted On2014-01-29