Incidental Mutation 'R1252:Lpl'
ID151802
Institutional Source Beutler Lab
Gene Symbol Lpl
Ensembl Gene ENSMUSG00000015568
Gene Namelipoprotein lipase
SynonymsO 1-4-5
MMRRC Submission 039319-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1252 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location68880491-68907448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68892659 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 105 (D105G)
Ref Sequence ENSEMBL: ENSMUSP00000132259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015712] [ENSMUST00000168401]
Predicted Effect probably benign
Transcript: ENSMUST00000015712
AA Change: D105G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000015712
Gene: ENSMUSG00000015568
AA Change: D105G

DomainStartEndE-ValueType
Pfam:Lipase 19 338 7.8e-133 PFAM
LH2 341 465 2.65e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101463
Predicted Effect probably benign
Transcript: ENSMUST00000168401
AA Change: D105G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000132259
Gene: ENSMUSG00000015568
AA Change: D105G

DomainStartEndE-ValueType
Pfam:Lipase 19 338 1.1e-117 PFAM
Pfam:Abhydrolase_6 76 264 3e-10 PFAM
LH2 341 465 2.65e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169749
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LPL encodes lipoprotein lipase, which is expressed in heart, muscle, and adipose tissue. LPL functions as a homodimer, and has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. Severe mutations that cause LPL deficiency result in type I hyperlipoproteinemia, while less extreme mutations in LPL are linked to many disorders of lipoprotein metabolism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations become cyanotic and die within 2 days of birth due to chylomicron engorgement of capillaries. Mutants show hypertriglyceridemia and reduced fat stores. Heterozygotes show 1.5-2-fold elevated triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsm2 C T 7: 119,573,245 H104Y probably benign Het
Adgrb3 G A 1: 25,128,828 T1009M probably damaging Het
Arfgef2 A G 2: 166,859,957 K755E probably damaging Het
Atm A T 9: 53,455,840 D2491E probably damaging Het
Bptf A G 11: 107,073,251 S1706P probably benign Het
Capn13 C T 17: 73,367,227 G77D possibly damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cep135 A G 5: 76,594,115 K133E possibly damaging Het
Cyp2c67 A G 19: 39,626,141 M314T possibly damaging Het
Dennd5b T C 6: 149,044,487 D542G probably damaging Het
Dpys A T 15: 39,824,240 N387K probably damaging Het
Erc1 A T 6: 119,743,392 D749E possibly damaging Het
Gm281 T C 14: 13,862,444 D370G probably benign Het
Gucy2e A T 11: 69,235,659 F298L probably benign Het
Igsf10 A G 3: 59,331,848 V304A probably benign Het
Kmt2b A T 7: 30,580,487 C1363S probably damaging Het
Krt83 A G 15: 101,487,830 Y295H probably damaging Het
Lmo7 T C 14: 101,900,583 V396A probably damaging Het
Lrrc45 C A 11: 120,715,471 T135N probably benign Het
Ltn1 C T 16: 87,416,030 A548T probably benign Het
Nectin2 T G 7: 19,717,598 I504L probably benign Het
Nmbr T C 10: 14,760,443 I52T probably benign Het
Nop14 A T 5: 34,650,555 N354K probably benign Het
Olfm1 A G 2: 28,229,435 I361V probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Ovol1 T C 19: 5,553,601 T91A probably benign Het
Pigz T A 16: 31,941,990 V3E possibly damaging Het
Pip4k2b T C 11: 97,744,594 N4S probably benign Het
Pqlc1 A G 18: 80,291,598 T211A possibly damaging Het
Slc23a2 A T 2: 132,062,197 probably null Het
Speg A T 1: 75,427,095 D2640V probably damaging Het
Trip12 G A 1: 84,776,350 Q111* probably null Het
Trub2 A G 2: 29,782,158 F141S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdfy4 A T 14: 32,971,772 probably null Het
Zfp935 A G 13: 62,454,541 F282L probably damaging Het
Zfp946 G T 17: 22,453,579 probably null Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Other mutations in Lpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Lpl APN 8 68902366 missense probably benign 0.00
IGL01161:Lpl APN 8 68892625 nonsense probably null
IGL01370:Lpl APN 8 68887568 missense possibly damaging 0.92
IGL01420:Lpl APN 8 68887433 splice site probably benign
IGL02034:Lpl APN 8 68880772 missense possibly damaging 0.64
IGL02227:Lpl APN 8 68895800 missense probably damaging 0.99
IGL02949:Lpl APN 8 68892748 missense probably damaging 1.00
IGL03237:Lpl APN 8 68894726 missense possibly damaging 0.90
Bensadoun UTSW 8 68896807 missense probably benign 0.03
R0064:Lpl UTSW 8 68892704 missense probably damaging 1.00
R0064:Lpl UTSW 8 68892704 missense probably damaging 1.00
R0490:Lpl UTSW 8 68896691 missense probably damaging 0.98
R1331:Lpl UTSW 8 68896629 missense probably damaging 0.99
R1376:Lpl UTSW 8 68887598 missense probably damaging 1.00
R1376:Lpl UTSW 8 68887598 missense probably damaging 1.00
R1444:Lpl UTSW 8 68892747 missense probably damaging 0.99
R1722:Lpl UTSW 8 68896602 frame shift probably null
R1826:Lpl UTSW 8 68902291 missense possibly damaging 0.62
R1867:Lpl UTSW 8 68896602 frame shift probably null
R1874:Lpl UTSW 8 68896619 missense probably damaging 1.00
R1970:Lpl UTSW 8 68896802 nonsense probably null
R2401:Lpl UTSW 8 68901243 missense possibly damaging 0.52
R2516:Lpl UTSW 8 68887518 missense probably benign 0.00
R2850:Lpl UTSW 8 68899512 nonsense probably null
R4688:Lpl UTSW 8 68899425 missense probably damaging 1.00
R4773:Lpl UTSW 8 68896751 missense probably damaging 1.00
R4962:Lpl UTSW 8 68894693 missense probably damaging 1.00
R4993:Lpl UTSW 8 68895793 missense probably benign 0.23
R5343:Lpl UTSW 8 68895737 missense probably damaging 1.00
R6018:Lpl UTSW 8 68901288 missense probably benign
R6082:Lpl UTSW 8 68896649 missense probably damaging 0.98
R6137:Lpl UTSW 8 68892747 missense probably damaging 0.99
R6589:Lpl UTSW 8 68896807 missense probably benign 0.03
R7730:Lpl UTSW 8 68887448 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACATTTGCCCTGGAAGTGGGAAAG -3'
(R):5'- CAGCCATGTGTCTAGCTCTAACCAAG -3'

Sequencing Primer
(F):5'- AGTTCTCAGCCTGAGCCAATG -3'
(R):5'- AGCTCTAACCAAGAGTTTTATCCC -3'
Posted On2014-01-29