Incidental Mutation 'R1252:Gm281'
ID151813
Institutional Source Beutler Lab
Gene Symbol Gm281
Ensembl Gene ENSMUSG00000084902
Gene Namepredicted gene 281
SynonymsLOC238939
MMRRC Submission 039319-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1252 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location13814618-13914478 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13862444 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 370 (D370G)
Ref Sequence ENSEMBL: ENSMUSP00000121887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144914]
Predicted Effect probably benign
Transcript: ENSMUST00000144914
AA Change: D370G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121887
Gene: ENSMUSG00000084902
AA Change: D370G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 32 127 3.45e-2 SMART
CA 156 230 7.87e-9 SMART
CA 274 352 1.36e-3 SMART
CA 376 470 6.99e-3 SMART
CA 492 563 8.69e-11 SMART
CA 589 683 2.09e-1 SMART
transmembrane domain 705 727 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsm2 C T 7: 119,573,245 H104Y probably benign Het
Adgrb3 G A 1: 25,128,828 T1009M probably damaging Het
Arfgef2 A G 2: 166,859,957 K755E probably damaging Het
Atm A T 9: 53,455,840 D2491E probably damaging Het
Bptf A G 11: 107,073,251 S1706P probably benign Het
Capn13 C T 17: 73,367,227 G77D possibly damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cep135 A G 5: 76,594,115 K133E possibly damaging Het
Cyp2c67 A G 19: 39,626,141 M314T possibly damaging Het
Dennd5b T C 6: 149,044,487 D542G probably damaging Het
Dpys A T 15: 39,824,240 N387K probably damaging Het
Erc1 A T 6: 119,743,392 D749E possibly damaging Het
Gucy2e A T 11: 69,235,659 F298L probably benign Het
Igsf10 A G 3: 59,331,848 V304A probably benign Het
Kmt2b A T 7: 30,580,487 C1363S probably damaging Het
Krt83 A G 15: 101,487,830 Y295H probably damaging Het
Lmo7 T C 14: 101,900,583 V396A probably damaging Het
Lpl A G 8: 68,892,659 D105G probably benign Het
Lrrc45 C A 11: 120,715,471 T135N probably benign Het
Ltn1 C T 16: 87,416,030 A548T probably benign Het
Nectin2 T G 7: 19,717,598 I504L probably benign Het
Nmbr T C 10: 14,760,443 I52T probably benign Het
Nop14 A T 5: 34,650,555 N354K probably benign Het
Olfm1 A G 2: 28,229,435 I361V probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Ovol1 T C 19: 5,553,601 T91A probably benign Het
Pigz T A 16: 31,941,990 V3E possibly damaging Het
Pip4k2b T C 11: 97,744,594 N4S probably benign Het
Pqlc1 A G 18: 80,291,598 T211A possibly damaging Het
Slc23a2 A T 2: 132,062,197 probably null Het
Speg A T 1: 75,427,095 D2640V probably damaging Het
Trip12 G A 1: 84,776,350 Q111* probably null Het
Trub2 A G 2: 29,782,158 F141S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdfy4 A T 14: 32,971,772 probably null Het
Zfp935 A G 13: 62,454,541 F282L probably damaging Het
Zfp946 G T 17: 22,453,579 probably null Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Other mutations in Gm281
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0115:Gm281 UTSW 14 13899571 missense probably damaging 0.99
R0842:Gm281 UTSW 14 13856686 missense probably benign 0.16
R1275:Gm281 UTSW 14 13896949 missense probably damaging 1.00
R1631:Gm281 UTSW 14 13829796 missense probably damaging 0.99
R1831:Gm281 UTSW 14 13899619 missense probably damaging 1.00
R1885:Gm281 UTSW 14 13828607 missense probably damaging 1.00
R1886:Gm281 UTSW 14 13828607 missense probably damaging 1.00
R1887:Gm281 UTSW 14 13828607 missense probably damaging 1.00
R1903:Gm281 UTSW 14 13829657 missense possibly damaging 0.94
R1940:Gm281 UTSW 14 13828582 missense probably null 0.95
R2324:Gm281 UTSW 14 13868077 missense probably damaging 1.00
R3923:Gm281 UTSW 14 13865990 nonsense probably null
R4193:Gm281 UTSW 14 13914416 missense probably benign 0.02
R4195:Gm281 UTSW 14 13829772 missense probably benign 0.05
R4370:Gm281 UTSW 14 13862375 missense probably benign 0.03
R4675:Gm281 UTSW 14 13856724 missense probably benign 0.32
R4734:Gm281 UTSW 14 13845292 missense probably benign 0.13
R5387:Gm281 UTSW 14 13914438 start codon destroyed probably null 0.82
R6037:Gm281 UTSW 14 13864282 missense probably damaging 1.00
R6037:Gm281 UTSW 14 13864282 missense probably damaging 1.00
R6177:Gm281 UTSW 14 13868002 missense probably benign 0.08
R7051:Gm281 UTSW 14 13828486 missense
R7205:Gm281 UTSW 14 13866032 missense
R7258:Gm281 UTSW 14 13899648 missense
R7833:Gm281 UTSW 14 13896968 splice site probably null
R8309:Gm281 UTSW 14 13814954 nonsense probably null
Z1177:Gm281 UTSW 14 13823754 missense
Z1177:Gm281 UTSW 14 13845421 missense
Predicted Primers PCR Primer
(F):5'- AGCATTCCAAGTGCCTTCTGGTATG -3'
(R):5'- TGCTCTAAGGAAGACCTGTCTGCTC -3'

Sequencing Primer
(F):5'- AAGTGCCTTCTGGTATGACAGC -3'
(R):5'- TGCTCCAGGATTATCAAGGC -3'
Posted On2014-01-29