Incidental Mutation 'R1252:Krt83'
ID151818
Institutional Source Beutler Lab
Gene Symbol Krt83
Ensembl Gene ENSMUSG00000047641
Gene Namekeratin 83
SynonymsKrt2-25
MMRRC Submission 039319-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1252 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101431490-101438804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101487830 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 295 (Y295H)
Ref Sequence ENSEMBL: ENSMUSP00000023718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023718]
Predicted Effect probably damaging
Transcript: ENSMUST00000023718
AA Change: Y295H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023718
Gene: ENSMUSG00000067613
AA Change: Y295H

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 100 5.9e-16 PFAM
Filament 103 414 7.02e-149 SMART
low complexity region 422 436 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230173
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsm2 C T 7: 119,573,245 H104Y probably benign Het
Adgrb3 G A 1: 25,128,828 T1009M probably damaging Het
Arfgef2 A G 2: 166,859,957 K755E probably damaging Het
Atm A T 9: 53,455,840 D2491E probably damaging Het
Bptf A G 11: 107,073,251 S1706P probably benign Het
Capn13 C T 17: 73,367,227 G77D possibly damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cep135 A G 5: 76,594,115 K133E possibly damaging Het
Cyp2c67 A G 19: 39,626,141 M314T possibly damaging Het
Dennd5b T C 6: 149,044,487 D542G probably damaging Het
Dpys A T 15: 39,824,240 N387K probably damaging Het
Erc1 A T 6: 119,743,392 D749E possibly damaging Het
Gm281 T C 14: 13,862,444 D370G probably benign Het
Gucy2e A T 11: 69,235,659 F298L probably benign Het
Igsf10 A G 3: 59,331,848 V304A probably benign Het
Kmt2b A T 7: 30,580,487 C1363S probably damaging Het
Lmo7 T C 14: 101,900,583 V396A probably damaging Het
Lpl A G 8: 68,892,659 D105G probably benign Het
Lrrc45 C A 11: 120,715,471 T135N probably benign Het
Ltn1 C T 16: 87,416,030 A548T probably benign Het
Nectin2 T G 7: 19,717,598 I504L probably benign Het
Nmbr T C 10: 14,760,443 I52T probably benign Het
Nop14 A T 5: 34,650,555 N354K probably benign Het
Olfm1 A G 2: 28,229,435 I361V probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Ovol1 T C 19: 5,553,601 T91A probably benign Het
Pigz T A 16: 31,941,990 V3E possibly damaging Het
Pip4k2b T C 11: 97,744,594 N4S probably benign Het
Pqlc1 A G 18: 80,291,598 T211A possibly damaging Het
Slc23a2 A T 2: 132,062,197 probably null Het
Speg A T 1: 75,427,095 D2640V probably damaging Het
Trip12 G A 1: 84,776,350 Q111* probably null Het
Trub2 A G 2: 29,782,158 F141S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdfy4 A T 14: 32,971,772 probably null Het
Zfp935 A G 13: 62,454,541 F282L probably damaging Het
Zfp946 G T 17: 22,453,579 probably null Het
Zkscan4 A G 13: 21,483,874 E165G probably benign Het
Other mutations in Krt83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Krt83 APN 15 101488211 missense probably benign 0.17
IGL01315:Krt83 APN 15 101486967 splice site probably benign
IGL01702:Krt83 APN 15 101491218 missense probably benign 0.18
IGL02123:Krt83 APN 15 101487585 missense possibly damaging 0.49
IGL02353:Krt83 APN 15 101485458 missense probably benign
IGL02360:Krt83 APN 15 101485458 missense probably benign
IGL02395:Krt83 APN 15 101487952 missense probably benign 0.18
IGL02633:Krt83 APN 15 101491214 missense probably damaging 1.00
R0357:Krt83 UTSW 15 101487019 missense probably benign 0.17
R0650:Krt83 UTSW 15 101487040 missense probably damaging 0.99
R0928:Krt83 UTSW 15 101491280 missense probably benign 0.00
R1126:Krt83 UTSW 15 101487482 missense probably damaging 0.98
R1196:Krt83 UTSW 15 101491433 missense probably benign 0.03
R1513:Krt83 UTSW 15 101489657 missense probably benign 0.30
R1612:Krt83 UTSW 15 101488211 missense probably benign 0.17
R1870:Krt83 UTSW 15 101487190 missense probably benign
R2173:Krt83 UTSW 15 101487937 missense probably damaging 0.98
R2432:Krt83 UTSW 15 101488156 nonsense probably null
R2568:Krt83 UTSW 15 101487827 missense possibly damaging 0.67
R2696:Krt83 UTSW 15 101487009 missense probably benign 0.01
R3508:Krt83 UTSW 15 101488158 missense probably benign 0.04
R4364:Krt83 UTSW 15 101487514 missense probably benign
R4366:Krt83 UTSW 15 101487514 missense probably benign
R4606:Krt83 UTSW 15 101487049 missense probably benign 0.18
R4721:Krt83 UTSW 15 101487982 missense probably damaging 1.00
R4784:Krt83 UTSW 15 101487956 missense probably damaging 1.00
R4987:Krt83 UTSW 15 101487009 missense probably benign
R5008:Krt83 UTSW 15 101491224 missense probably damaging 1.00
R5101:Krt83 UTSW 15 101487510 missense probably benign 0.14
R5367:Krt83 UTSW 15 101486994 missense probably damaging 1.00
R5516:Krt83 UTSW 15 101487121 nonsense probably null
R5949:Krt83 UTSW 15 101487595 missense probably damaging 0.99
R5972:Krt83 UTSW 15 101487586 missense probably benign
R6036:Krt83 UTSW 15 101487531 missense possibly damaging 0.78
R6036:Krt83 UTSW 15 101487531 missense possibly damaging 0.78
R6135:Krt83 UTSW 15 101487534 missense probably damaging 1.00
R7151:Krt83 UTSW 15 101489648 missense probably damaging 1.00
R7186:Krt83 UTSW 15 101487202 splice site probably null
R7297:Krt83 UTSW 15 101489647 missense probably benign 0.42
R7708:Krt83 UTSW 15 101487932 missense probably benign 0.00
R7796:Krt83 UTSW 15 101485984 missense possibly damaging 0.95
R8172:Krt83 UTSW 15 101485403 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGCAAGATGCACAGTGGTCAGG -3'
(R):5'- CCAGGTGGAAGTCCAACAAGTAGTC -3'

Sequencing Primer
(F):5'- ACAGTGGTCAGGCTGGG -3'
(R):5'- ATTCCGTGACTGTGAAGTCC -3'
Posted On2014-01-29