Mutagenetix > Incidental Mutation

Incidental Mutation 'R1252:Ltn1'

151820

Institutional Source

Beutler Lab

Gene Symbol

Ltn1

Ensembl Gene

ENSMUSG00000052299

Gene Name

listerin E3 ubiquitin protein ligase 1

Synonyms

4930528H02Rik, Rnf160, Zfp294, Listerin

MMRRC Submission

039319-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1252 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87376651-87432612 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 87416030 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 548 (A548T)

Ref Sequence

ENSEMBL: ENSMUSP00000156299 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039449] [ENSMUST00000232095]

AlphaFold

Q6A009

Predicted Effect

probably benign
Transcript: ENSMUST00000039449
AA Change: A548T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299
AA Change: A548T

Domain	Start	End	E-Value	Type
low complexity region	160	176	N/A	INTRINSIC
low complexity region	400	410	N/A	INTRINSIC
low complexity region	509	522	N/A	INTRINSIC
low complexity region	553	569	N/A	INTRINSIC
low complexity region	815	832	N/A	INTRINSIC
low complexity region	1380	1392	N/A	INTRINSIC
low complexity region	1427	1451	N/A	INTRINSIC
RING	1716	1762	1.05e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083713

Predicted Effect

probably benign
Transcript: ENSMUST00000232095
AA Change: A548T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Acsm2	C	T	7: 119,573,245	H104Y	probably benign	Het
Adgrb3	G	A	1: 25,128,828	T1009M	probably damaging	Het
Arfgef2	A	G	2: 166,859,957	K755E	probably damaging	Het
Atm	A	T	9: 53,455,840	D2491E	probably damaging	Het
Bptf	A	G	11: 107,073,251	S1706P	probably benign	Het
Capn13	C	T	17: 73,367,227	G77D	possibly damaging	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Cep135	A	G	5: 76,594,115	K133E	possibly damaging	Het
Cyp2c67	A	G	19: 39,626,141	M314T	possibly damaging	Het
Dennd5b	T	C	6: 149,044,487	D542G	probably damaging	Het
Dpys	A	T	15: 39,824,240	N387K	probably damaging	Het
Erc1	A	T	6: 119,743,392	D749E	possibly damaging	Het
Gm281	T	C	14: 13,862,444	D370G	probably benign	Het
Gucy2e	A	T	11: 69,235,659	F298L	probably benign	Het
Igsf10	A	G	3: 59,331,848	V304A	probably benign	Het
Kmt2b	A	T	7: 30,580,487	C1363S	probably damaging	Het
Krt83	A	G	15: 101,487,830	Y295H	probably damaging	Het
Lmo7	T	C	14: 101,900,583	V396A	probably damaging	Het
Lpl	A	G	8: 68,892,659	D105G	probably benign	Het
Lrrc45	C	A	11: 120,715,471	T135N	probably benign	Het
Nectin2	T	G	7: 19,717,598	I504L	probably benign	Het
Nmbr	T	C	10: 14,760,443	I52T	probably benign	Het
Nop14	A	T	5: 34,650,555	N354K	probably benign	Het
Olfm1	A	G	2: 28,229,435	I361V	probably benign	Het
Olfr1537	G	C	9: 39,238,251	P58A	probably benign	Het
Ovol1	T	C	19: 5,553,601	T91A	probably benign	Het
Pigz	T	A	16: 31,941,990	V3E	possibly damaging	Het
Pip4k2b	T	C	11: 97,744,594	N4S	probably benign	Het
Pqlc1	A	G	18: 80,291,598	T211A	possibly damaging	Het
Slc23a2	A	T	2: 132,062,197		probably null	Het
Speg	A	T	1: 75,427,095	D2640V	probably damaging	Het
Trip12	G	A	1: 84,776,350	Q111*	probably null	Het
Trub2	A	G	2: 29,782,158	F141S	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Wdfy4	A	T	14: 32,971,772		probably null	Het
Zfp935	A	G	13: 62,454,541	F282L	probably damaging	Het
Zfp946	G	T	17: 22,453,579		probably null	Het
Zkscan4	A	G	13: 21,483,874	E165G	probably benign	Het

Other mutations in Ltn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00328:Ltn1	APN	16	87418490	missense	probably benign	0.03
IGL01139:Ltn1	APN	16	87416009	missense	probably benign	0.04
IGL01359:Ltn1	APN	16	87405693	splice site	probably benign
IGL01503:Ltn1	APN	16	87420807	critical splice donor site	probably benign
IGL01529:Ltn1	APN	16	87381471	missense	probably benign	0.00
IGL02437:Ltn1	APN	16	87398001	missense	probably benign	0.04
IGL02658:Ltn1	APN	16	87415774	missense	probably damaging	1.00
IGL02890:Ltn1	APN	16	87409297	splice site	probably null
IGL02899:Ltn1	APN	16	87382659	missense	probably benign	0.34
IGL02902:Ltn1	APN	16	87379805	missense	possibly damaging	0.70
IGL03128:Ltn1	APN	16	87415944	missense	probably benign	0.00
IGL03392:Ltn1	APN	16	87425611	missense	probably damaging	1.00
IGL03046:Ltn1	UTSW	16	87405621	missense	probably benign	0.10
PIT4305001:Ltn1	UTSW	16	87420323	missense	probably damaging	1.00
PIT4366001:Ltn1	UTSW	16	87380840	nonsense	probably null
R0126:Ltn1	UTSW	16	87425640	missense	probably benign	0.00
R0164:Ltn1	UTSW	16	87405519	splice site	probably benign
R0165:Ltn1	UTSW	16	87405519	splice site	probably benign
R0280:Ltn1	UTSW	16	87397838	missense	probably damaging	1.00
R0565:Ltn1	UTSW	16	87416010	missense	probably benign	0.01
R0733:Ltn1	UTSW	16	87412507	missense	probably benign	0.01
R1034:Ltn1	UTSW	16	87397137	splice site	probably null
R1524:Ltn1	UTSW	16	87381556	missense	probably damaging	1.00
R1746:Ltn1	UTSW	16	87411781	missense	possibly damaging	0.86
R1826:Ltn1	UTSW	16	87415616	missense	probably damaging	1.00
R1831:Ltn1	UTSW	16	87400146	missense	possibly damaging	0.94
R1839:Ltn1	UTSW	16	87416264	nonsense	probably null
R1860:Ltn1	UTSW	16	87416343	missense	probably benign	0.06
R1997:Ltn1	UTSW	16	87381637	missense	probably damaging	1.00
R2109:Ltn1	UTSW	16	87415642	missense	probably benign	0.03
R2134:Ltn1	UTSW	16	87382713	missense	probably damaging	1.00
R2135:Ltn1	UTSW	16	87382713	missense	probably damaging	1.00
R2193:Ltn1	UTSW	16	87427647	missense	probably damaging	1.00
R2307:Ltn1	UTSW	16	87432424	critical splice donor site	probably null
R2376:Ltn1	UTSW	16	87420807	critical splice donor site	probably null
R3054:Ltn1	UTSW	16	87404073	missense	probably benign	0.32
R3404:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3405:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3618:Ltn1	UTSW	16	87420899	missense	probably damaging	1.00
R4065:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4066:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4067:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4288:Ltn1	UTSW	16	87397988	missense	possibly damaging	0.57
R4436:Ltn1	UTSW	16	87405614	missense	probably benign	0.17
R4535:Ltn1	UTSW	16	87426286	missense	probably damaging	1.00
R4581:Ltn1	UTSW	16	87402024	critical splice donor site	probably null
R4669:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R4715:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R4830:Ltn1	UTSW	16	87379694	missense	probably damaging	1.00
R4887:Ltn1	UTSW	16	87398809	nonsense	probably null
R4961:Ltn1	UTSW	16	87397791	missense	probably benign
R4992:Ltn1	UTSW	16	87405587	missense	possibly damaging	0.70
R5073:Ltn1	UTSW	16	87427740	missense	probably damaging	0.99
R5288:Ltn1	UTSW	16	87416011	missense	possibly damaging	0.80
R5802:Ltn1	UTSW	16	87415681	missense	probably benign	0.17
R5907:Ltn1	UTSW	16	87381503	missense	possibly damaging	0.94
R6180:Ltn1	UTSW	16	87427789	missense	probably damaging	1.00
R6194:Ltn1	UTSW	16	87415810	missense	probably damaging	1.00
R6257:Ltn1	UTSW	16	87411774	missense	possibly damaging	0.74
R6301:Ltn1	UTSW	16	87420306	missense	probably benign
R6481:Ltn1	UTSW	16	87378980	missense	probably damaging	1.00
R6525:Ltn1	UTSW	16	87420186	missense	probably damaging	1.00
R6958:Ltn1	UTSW	16	87397791	missense	probably benign
R6969:Ltn1	UTSW	16	87415690	missense	probably damaging	1.00
R7002:Ltn1	UTSW	16	87423473	missense	probably benign
R7038:Ltn1	UTSW	16	87424871	missense	probably damaging	1.00
R7062:Ltn1	UTSW	16	87427603	missense	probably damaging	0.98
R7152:Ltn1	UTSW	16	87427641	missense	probably damaging	1.00
R7180:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R7247:Ltn1	UTSW	16	87409387	missense	probably benign	0.00
R7454:Ltn1	UTSW	16	87397812	missense	probably benign	0.03
R7471:Ltn1	UTSW	16	87397899	missense	probably benign
R7511:Ltn1	UTSW	16	87408828	missense	possibly damaging	0.63
R7691:Ltn1	UTSW	16	87398686	missense	probably damaging	0.99
R7702:Ltn1	UTSW	16	87426278	missense	probably damaging	1.00
R7761:Ltn1	UTSW	16	87411793	missense	probably benign
R8002:Ltn1	UTSW	16	87415947	missense	probably benign	0.17
R8101:Ltn1	UTSW	16	87418497	missense	probably damaging	1.00
R8142:Ltn1	UTSW	16	87381641	missense	probably benign	0.21
R8214:Ltn1	UTSW	16	87380803	missense	probably benign	0.02
R8674:Ltn1	UTSW	16	87398785	missense	probably benign
R8783:Ltn1	UTSW	16	87410359	missense	probably benign	0.30
R8839:Ltn1	UTSW	16	87418502	missense	probably damaging	1.00
R8885:Ltn1	UTSW	16	87381545	missense	probably damaging	1.00
R8889:Ltn1	UTSW	16	87432342	intron	probably benign
R8892:Ltn1	UTSW	16	87432342	intron	probably benign
R8919:Ltn1	UTSW	16	87381493	missense	probably damaging	0.98
R8970:Ltn1	UTSW	16	87416038	missense	probably benign
R9113:Ltn1	UTSW	16	87427644	missense	probably damaging	1.00
R9206:Ltn1	UTSW	16	87400410	missense	probably benign	0.00
R9208:Ltn1	UTSW	16	87400410	missense	probably benign	0.00
R9234:Ltn1	UTSW	16	87397201	missense	probably damaging	0.98
R9421:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R9558:Ltn1	UTSW	16	87423407	missense	probably benign	0.05
R9654:Ltn1	UTSW	16	87410339	missense	probably benign	0.00
R9738:Ltn1	UTSW	16	87425636	missense	probably damaging	1.00
X0028:Ltn1	UTSW	16	87402134	missense	probably benign	0.01
Z1177:Ltn1	UTSW	16	87402037	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTCGTTGACAAAGCTAATGCTCAC -3'
(R):5'- AGCTCTTGGGAAGCCAAAGCAG -3'

Sequencing Primer
(F):5'- AAGCTAATGCTCACCTCTGC -3'
(R):5'- GACCCTGGAGCTGTTTACAAC -3'

Posted On

2014-01-29