Incidental Mutation 'R1253:Actg2'
ID151840
Institutional Source Beutler Lab
Gene Symbol Actg2
Ensembl Gene ENSMUSG00000059430
Gene Nameactin, gamma 2, smooth muscle, enteric
SynonymsAct4, Act-4, ACTA3, SMGA
MMRRC Submission 039320-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1253 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83512905-83536265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83522887 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 127 (T127I)
Ref Sequence ENSEMBL: ENSMUSP00000120936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075161] [ENSMUST00000121731] [ENSMUST00000141904] [ENSMUST00000152029] [ENSMUST00000205926]
Predicted Effect probably damaging
Transcript: ENSMUST00000075161
AA Change: T127I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074658
Gene: ENSMUSG00000059430
AA Change: T127I

DomainStartEndE-ValueType
ACTIN 6 376 6.01e-236 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121731
AA Change: T127I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113552
Gene: ENSMUSG00000059430
AA Change: T127I

DomainStartEndE-ValueType
ACTIN 6 376 6.01e-236 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124933
Predicted Effect probably damaging
Transcript: ENSMUST00000141904
AA Change: T127I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120936
Gene: ENSMUSG00000059430
AA Change: T127I

DomainStartEndE-ValueType
ACTIN 6 270 4.78e-116 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152029
AA Change: T127I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121577
Gene: ENSMUSG00000059430
AA Change: T127I

DomainStartEndE-ValueType
ACTIN 6 195 1.09e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000205926
AA Change: T54I

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Actins are highly conserved proteins that are involved in various types of cell motility and in the maintenance of the cytoskeleton. Three types of actins, alpha, beta and gamma, have been identified in vertebrates. Alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton and as mediators of internal cell motility. This gene encodes actin gamma 2; a smooth muscle actin found in enteric tissues. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Based on similarity to peptide cleavage of related actins, the mature protein of this gene is formed by removal of two N-terminal peptides.[provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aph1b T A 9: 66,790,649 K102* probably null Het
Caskin1 A G 17: 24,505,073 K945R probably damaging Het
Ccdc137 C A 11: 120,458,179 A12E probably benign Het
Cdhr1 A G 14: 37,079,625 M787T probably benign Het
Cic T A 7: 25,290,948 V1958E probably damaging Het
Col6a6 T A 9: 105,774,303 I1170F probably null Het
Cyp2c54 T A 19: 40,046,185 Y347F probably damaging Het
Kntc1 AGTGT AGT 5: 123,810,862 probably null Het
Large1 T C 8: 73,048,422 Y220C probably damaging Het
Macf1 A T 4: 123,457,967 D1592E probably damaging Het
Mtus2 C T 5: 148,303,570 Q76* probably null Het
Olfm3 A T 3: 115,122,769 D450V probably damaging Het
Olfr290 T A 7: 84,916,709 I310K probably benign Het
Olfr364-ps1 T A 2: 37,146,872 V220D possibly damaging Het
Olfr731 A G 14: 50,238,124 C254R probably damaging Het
Ormdl1 G A 1: 53,305,522 R81K possibly damaging Het
Pcdhb12 G A 18: 37,435,821 V7I possibly damaging Het
Ptprt A G 2: 162,278,226 I107T probably damaging Het
Rbm27 A C 18: 42,301,774 D301A probably damaging Het
Rexo2 A T 9: 48,468,932 I200N probably damaging Het
Rtn4ip1 A T 10: 43,910,871 I192L probably benign Het
Serpinb9e T C 13: 33,255,119 F176S possibly damaging Het
Sorcs3 C A 19: 48,206,736 A186E possibly damaging Het
Spata31 A G 13: 64,922,024 Y662C probably benign Het
Sphkap G A 1: 83,278,898 P377S possibly damaging Het
Srrt T C 5: 137,300,336 K222R probably benign Het
Tas2r129 T C 6: 132,952,036 I312T probably benign Het
Thbs4 G T 13: 92,776,905 P169Q probably benign Het
Tmtc3 T C 10: 100,451,390 M515V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Other mutations in Actg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Actg2 APN 6 83523175 missense probably damaging 1.00
PIT4508001:Actg2 UTSW 6 83513007 missense possibly damaging 0.92
R0309:Actg2 UTSW 6 83519914 missense probably damaging 1.00
R0319:Actg2 UTSW 6 83520743 missense probably damaging 1.00
R1619:Actg2 UTSW 6 83523187 missense probably damaging 1.00
R1677:Actg2 UTSW 6 83522819 missense possibly damaging 0.92
R2512:Actg2 UTSW 6 83526847 missense probably damaging 1.00
R4127:Actg2 UTSW 6 83522884 missense possibly damaging 0.86
R4195:Actg2 UTSW 6 83523173 missense probably damaging 1.00
R5165:Actg2 UTSW 6 83526832 missense probably benign 0.22
R5661:Actg2 UTSW 6 83520772 missense probably damaging 0.98
R6030:Actg2 UTSW 6 83516364 missense probably damaging 1.00
R6030:Actg2 UTSW 6 83516364 missense probably damaging 1.00
R6707:Actg2 UTSW 6 83513094 nonsense probably null
R7069:Actg2 UTSW 6 83520763 missense probably damaging 1.00
R7763:Actg2 UTSW 6 83527368 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTATCCAGCCTGACCATGTTTGC -3'
(R):5'- TTCGAGTAGCACCAGAAGAGCACC -3'

Sequencing Primer
(F):5'- GGCTTGCTATAAACTTGCCACAG -3'
(R):5'- TCAGCACTGTGTAGCAATGC -3'
Posted On2014-01-29