Incidental Mutation 'R1253:Tas2r129'
ID151841
Institutional Source Beutler Lab
Gene Symbol Tas2r129
Ensembl Gene ENSMUSG00000063762
Gene Nametaste receptor, type 2, member 129
SynonymsTas2r29, mt2r60, T2R29, mGR29
MMRRC Submission 039320-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R1253 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location132951102-132952066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132952036 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 312 (I312T)
Ref Sequence ENSEMBL: ENSMUSP00000067640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070991] [ENSMUST00000082085]
Predicted Effect probably benign
Transcript: ENSMUST00000070991
AA Change: I312T

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000067640
Gene: ENSMUSG00000063762
AA Change: I312T

DomainStartEndE-ValueType
Pfam:TAS2R 1 302 2.3e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082085
SMART Domains Protein: ENSMUSP00000080736
Gene: ENSMUSG00000057699

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 1.2e-66 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 G A 6: 83,522,887 T127I probably damaging Het
Aph1b T A 9: 66,790,649 K102* probably null Het
Caskin1 A G 17: 24,505,073 K945R probably damaging Het
Ccdc137 C A 11: 120,458,179 A12E probably benign Het
Cdhr1 A G 14: 37,079,625 M787T probably benign Het
Cic T A 7: 25,290,948 V1958E probably damaging Het
Col6a6 T A 9: 105,774,303 I1170F probably null Het
Cyp2c54 T A 19: 40,046,185 Y347F probably damaging Het
Kntc1 AGTGT AGT 5: 123,810,862 probably null Het
Large1 T C 8: 73,048,422 Y220C probably damaging Het
Macf1 A T 4: 123,457,967 D1592E probably damaging Het
Mtus2 C T 5: 148,303,570 Q76* probably null Het
Olfm3 A T 3: 115,122,769 D450V probably damaging Het
Olfr290 T A 7: 84,916,709 I310K probably benign Het
Olfr364-ps1 T A 2: 37,146,872 V220D possibly damaging Het
Olfr731 A G 14: 50,238,124 C254R probably damaging Het
Ormdl1 G A 1: 53,305,522 R81K possibly damaging Het
Pcdhb12 G A 18: 37,435,821 V7I possibly damaging Het
Ptprt A G 2: 162,278,226 I107T probably damaging Het
Rbm27 A C 18: 42,301,774 D301A probably damaging Het
Rexo2 A T 9: 48,468,932 I200N probably damaging Het
Rtn4ip1 A T 10: 43,910,871 I192L probably benign Het
Serpinb9e T C 13: 33,255,119 F176S possibly damaging Het
Sorcs3 C A 19: 48,206,736 A186E possibly damaging Het
Spata31 A G 13: 64,922,024 Y662C probably benign Het
Sphkap G A 1: 83,278,898 P377S possibly damaging Het
Srrt T C 5: 137,300,336 K222R probably benign Het
Thbs4 G T 13: 92,776,905 P169Q probably benign Het
Tmtc3 T C 10: 100,451,390 M515V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Other mutations in Tas2r129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Tas2r129 APN 6 132951394 nonsense probably null
R0389:Tas2r129 UTSW 6 132951196 missense probably benign 0.26
R0443:Tas2r129 UTSW 6 132951196 missense probably benign 0.26
R0487:Tas2r129 UTSW 6 132951943 missense probably benign 0.26
R0487:Tas2r129 UTSW 6 132951944 missense probably benign 0.31
R0576:Tas2r129 UTSW 6 132951534 missense probably benign 0.38
R3124:Tas2r129 UTSW 6 132951448 missense probably damaging 1.00
R4493:Tas2r129 UTSW 6 132951354 missense probably benign 0.31
R4494:Tas2r129 UTSW 6 132951354 missense probably benign 0.31
R4591:Tas2r129 UTSW 6 132951611 missense probably benign 0.10
R6156:Tas2r129 UTSW 6 132951492 missense probably benign 0.31
R6495:Tas2r129 UTSW 6 132951165 missense probably benign 0.00
R7600:Tas2r129 UTSW 6 132951174 nonsense probably null
R7608:Tas2r129 UTSW 6 132951193 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCCCACATCAGAGTCTTGCAAAC -3'
(R):5'- TGATAGCCAATGCAATCTCAGCCC -3'

Sequencing Primer
(F):5'- TCCATGCAAATTTTGAGGAGTGAG -3'
(R):5'- AGTAGCTCATGTGTCTCAGC -3'
Posted On2014-01-29