Incidental Mutation 'R1253:Large1'
ID 151845
Institutional Source Beutler Lab
Gene Symbol Large1
Ensembl Gene ENSMUSG00000004383
Gene Name LARGE xylosyl- and glucuronyltransferase 1
Synonyms froggy, BPFD#36, fg, enr
MMRRC Submission 039320-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R1253 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 72814599-73353540 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73048422 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 220 (Y220C)
Ref Sequence ENSEMBL: ENSMUSP00000148336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]
AlphaFold Q9Z1M7
Predicted Effect probably damaging
Transcript: ENSMUST00000004497
AA Change: Y220C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: Y220C

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
coiled coil region 55 90 N/A INTRINSIC
Pfam:Glyco_transf_8 141 387 6.2e-22 PFAM
Pfam:Glyco_transf_49 473 540 5.2e-15 PFAM
Pfam:Glyco_transf_49 535 743 1.1e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119826
AA Change: Y220C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: Y220C

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
coiled coil region 55 90 N/A INTRINSIC
Pfam:Glyco_transf_8 142 386 3e-23 PFAM
Pfam:Glyco_transf_49 473 540 2.3e-11 PFAM
Pfam:Glyco_transf_49 520 743 2.7e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146249
Predicted Effect probably damaging
Transcript: ENSMUST00000212459
AA Change: Y220C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 G A 6: 83,522,887 T127I probably damaging Het
Aph1b T A 9: 66,790,649 K102* probably null Het
Caskin1 A G 17: 24,505,073 K945R probably damaging Het
Ccdc137 C A 11: 120,458,179 A12E probably benign Het
Cdhr1 A G 14: 37,079,625 M787T probably benign Het
Cic T A 7: 25,290,948 V1958E probably damaging Het
Col6a6 T A 9: 105,774,303 I1170F probably null Het
Cyp2c54 T A 19: 40,046,185 Y347F probably damaging Het
Kntc1 AGTGT AGT 5: 123,810,862 probably null Het
Macf1 A T 4: 123,457,967 D1592E probably damaging Het
Mtus2 C T 5: 148,303,570 Q76* probably null Het
Olfm3 A T 3: 115,122,769 D450V probably damaging Het
Olfr290 T A 7: 84,916,709 I310K probably benign Het
Olfr364-ps1 T A 2: 37,146,872 V220D possibly damaging Het
Olfr731 A G 14: 50,238,124 C254R probably damaging Het
Ormdl1 G A 1: 53,305,522 R81K possibly damaging Het
Pcdhb12 G A 18: 37,435,821 V7I possibly damaging Het
Ptprt A G 2: 162,278,226 I107T probably damaging Het
Rbm27 A C 18: 42,301,774 D301A probably damaging Het
Rexo2 A T 9: 48,468,932 I200N probably damaging Het
Rtn4ip1 A T 10: 43,910,871 I192L probably benign Het
Serpinb9e T C 13: 33,255,119 F176S possibly damaging Het
Sorcs3 C A 19: 48,206,736 A186E possibly damaging Het
Spata31 A G 13: 64,922,024 Y662C probably benign Het
Sphkap G A 1: 83,278,898 P377S possibly damaging Het
Srrt T C 5: 137,300,336 K222R probably benign Het
Tas2r129 T C 6: 132,952,036 I312T probably benign Het
Thbs4 G T 13: 92,776,905 P169Q probably benign Het
Tmtc3 T C 10: 100,451,390 M515V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Other mutations in Large1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Large1 APN 8 72837497 missense probably damaging 1.00
IGL00326:Large1 APN 8 73131983 missense probably benign
IGL00418:Large1 APN 8 72823841 critical splice acceptor site probably null
IGL01155:Large1 APN 8 73131989 missense probably benign 0.01
IGL01793:Large1 APN 8 72859181 splice site probably benign
IGL01929:Large1 APN 8 72859275 missense probably damaging 1.00
IGL02218:Large1 APN 8 72912122 missense probably damaging 1.00
IGL02276:Large1 APN 8 72818093 missense probably benign 0.00
IGL02329:Large1 APN 8 73048317 missense possibly damaging 0.80
IGL02543:Large1 APN 8 73048414 missense probably benign 0.00
IGL02887:Large1 APN 8 73132039 missense probably benign 0.07
biggs UTSW 8 73116419 missense probably damaging 1.00
umber UTSW 8 72883264 nonsense probably null
R0179:Large1 UTSW 8 73098846 missense probably benign 0.09
R0477:Large1 UTSW 8 72818082 missense probably damaging 1.00
R0587:Large1 UTSW 8 72859333 missense probably damaging 1.00
R0791:Large1 UTSW 8 73048479 splice site probably benign
R1695:Large1 UTSW 8 72818082 missense probably damaging 1.00
R2017:Large1 UTSW 8 72852197 missense probably damaging 1.00
R4835:Large1 UTSW 8 73048347 missense probably damaging 1.00
R5105:Large1 UTSW 8 72852244 nonsense probably null
R5120:Large1 UTSW 8 72859341 missense probably damaging 1.00
R5135:Large1 UTSW 8 72818096 missense probably benign 0.38
R5137:Large1 UTSW 8 73048309 missense possibly damaging 0.58
R5567:Large1 UTSW 8 72837453 missense possibly damaging 0.93
R5945:Large1 UTSW 8 72852200 missense probably damaging 0.99
R6619:Large1 UTSW 8 72883264 nonsense probably null
R6951:Large1 UTSW 8 73116419 missense probably damaging 1.00
R7041:Large1 UTSW 8 73116464 missense probably damaging 0.98
R7300:Large1 UTSW 8 72837596 missense probably damaging 1.00
R7493:Large1 UTSW 8 72823715 missense probably benign 0.23
R7877:Large1 UTSW 8 73116443 missense probably damaging 1.00
R8118:Large1 UTSW 8 73131944 missense probably benign 0.40
R8129:Large1 UTSW 8 72815957 missense probably damaging 1.00
R8525:Large1 UTSW 8 72837492 missense probably damaging 1.00
R8963:Large1 UTSW 8 72815984 missense probably damaging 1.00
R9170:Large1 UTSW 8 72816017 missense probably benign 0.00
Z1088:Large1 UTSW 8 72912103 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGACAATcacagacacacacacac -3'
(R):5'- GGAAGCACTCACACTAACTTAGCCG -3'

Sequencing Primer
(F):5'- gacacacacacacacacac -3'
(R):5'- TGCTAATAGCAATAAAGCCTGTC -3'
Posted On 2014-01-29