Incidental Mutation 'R1253:Rexo2'
ID151846
Institutional Source Beutler Lab
Gene Symbol Rexo2
Ensembl Gene ENSMUSG00000032026
Gene NameRNA exonuclease 2
SynonymsSfn, 1810038D15Rik, Smfn
MMRRC Submission 039320-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1253 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location48468512-48480623 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48468932 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 200 (I200N)
Ref Sequence ENSEMBL: ENSMUSP00000034524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034524] [ENSMUST00000213895]
Predicted Effect probably damaging
Transcript: ENSMUST00000034524
AA Change: I200N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034524
Gene: ENSMUSG00000032026
AA Change: I200N

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
low complexity region 27 40 N/A INTRINSIC
EXOIII 42 216 4.66e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213508
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213875
Predicted Effect probably benign
Transcript: ENSMUST00000213895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216142
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 3'-to-5' exonuclease specific for small (primarily 5 nucleotides or less in length) single-stranded RNA and DNA oligomers. This protein may have a role in DNA repair, replication, and recombination, and in RNA processing and degradation. It may also be involved in resistance of human cells to UV-C-induced cell death through its role in the DNA repair process. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 G A 6: 83,522,887 T127I probably damaging Het
Aph1b T A 9: 66,790,649 K102* probably null Het
Caskin1 A G 17: 24,505,073 K945R probably damaging Het
Ccdc137 C A 11: 120,458,179 A12E probably benign Het
Cdhr1 A G 14: 37,079,625 M787T probably benign Het
Cic T A 7: 25,290,948 V1958E probably damaging Het
Col6a6 T A 9: 105,774,303 I1170F probably null Het
Cyp2c54 T A 19: 40,046,185 Y347F probably damaging Het
Kntc1 AGTGT AGT 5: 123,810,862 probably null Het
Large1 T C 8: 73,048,422 Y220C probably damaging Het
Macf1 A T 4: 123,457,967 D1592E probably damaging Het
Mtus2 C T 5: 148,303,570 Q76* probably null Het
Olfm3 A T 3: 115,122,769 D450V probably damaging Het
Olfr290 T A 7: 84,916,709 I310K probably benign Het
Olfr364-ps1 T A 2: 37,146,872 V220D possibly damaging Het
Olfr731 A G 14: 50,238,124 C254R probably damaging Het
Ormdl1 G A 1: 53,305,522 R81K possibly damaging Het
Pcdhb12 G A 18: 37,435,821 V7I possibly damaging Het
Ptprt A G 2: 162,278,226 I107T probably damaging Het
Rbm27 A C 18: 42,301,774 D301A probably damaging Het
Rtn4ip1 A T 10: 43,910,871 I192L probably benign Het
Serpinb9e T C 13: 33,255,119 F176S possibly damaging Het
Sorcs3 C A 19: 48,206,736 A186E possibly damaging Het
Spata31 A G 13: 64,922,024 Y662C probably benign Het
Sphkap G A 1: 83,278,898 P377S possibly damaging Het
Srrt T C 5: 137,300,336 K222R probably benign Het
Tas2r129 T C 6: 132,952,036 I312T probably benign Het
Thbs4 G T 13: 92,776,905 P169Q probably benign Het
Tmtc3 T C 10: 100,451,390 M515V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Other mutations in Rexo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Rexo2 APN 9 48474447 missense probably damaging 1.00
IGL01634:Rexo2 APN 9 48468915 missense probably damaging 1.00
R0014:Rexo2 UTSW 9 48474447 missense probably benign 0.31
R1534:Rexo2 UTSW 9 48468890 missense probably damaging 0.99
R2062:Rexo2 UTSW 9 48474513 missense possibly damaging 0.94
R3789:Rexo2 UTSW 9 48473062 missense probably damaging 1.00
R4343:Rexo2 UTSW 9 48468848 missense possibly damaging 0.95
R4594:Rexo2 UTSW 9 48480417 missense probably damaging 1.00
R4907:Rexo2 UTSW 9 48479403 splice site probably null
R4972:Rexo2 UTSW 9 48479389 missense probably damaging 1.00
R5833:Rexo2 UTSW 9 48468871 missense probably benign
R5861:Rexo2 UTSW 9 48475181 missense probably damaging 1.00
R6111:Rexo2 UTSW 9 48473112 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGAGACGCTAACGTGGCTTCTG -3'
(R):5'- CGCCCCTAACTATTGCATAGTGGTTC -3'

Sequencing Primer
(F):5'- GTGGCTTCTGAGAGCCAG -3'
(R):5'- TCCTGGGTGACTTGGAACAA -3'
Posted On2014-01-29