Incidental Mutation 'R1253:Olfr731'
ID151857
Institutional Source Beutler Lab
Gene Symbol Olfr731
Ensembl Gene ENSMUSG00000048080
Gene Nameolfactory receptor 731
SynonymsMOR246-5, GA_x6K02T2PMLR-5936117-5935137
MMRRC Submission 039320-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1253 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50233531-50241866 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50238124 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 254 (C254R)
Ref Sequence ENSEMBL: ENSMUSP00000150683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059565] [ENSMUST00000214152] [ENSMUST00000214388]
Predicted Effect probably damaging
Transcript: ENSMUST00000059565
AA Change: C254R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050705
Gene: ENSMUSG00000048080
AA Change: C254R

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 8.5e-51 PFAM
Pfam:7tm_1 41 287 5.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213322
Predicted Effect probably damaging
Transcript: ENSMUST00000214152
AA Change: C254R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214388
AA Change: C254R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 G A 6: 83,522,887 T127I probably damaging Het
Aph1b T A 9: 66,790,649 K102* probably null Het
Caskin1 A G 17: 24,505,073 K945R probably damaging Het
Ccdc137 C A 11: 120,458,179 A12E probably benign Het
Cdhr1 A G 14: 37,079,625 M787T probably benign Het
Cic T A 7: 25,290,948 V1958E probably damaging Het
Col6a6 T A 9: 105,774,303 I1170F probably null Het
Cyp2c54 T A 19: 40,046,185 Y347F probably damaging Het
Kntc1 AGTGT AGT 5: 123,810,862 probably null Het
Large1 T C 8: 73,048,422 Y220C probably damaging Het
Macf1 A T 4: 123,457,967 D1592E probably damaging Het
Mtus2 C T 5: 148,303,570 Q76* probably null Het
Olfm3 A T 3: 115,122,769 D450V probably damaging Het
Olfr290 T A 7: 84,916,709 I310K probably benign Het
Olfr364-ps1 T A 2: 37,146,872 V220D possibly damaging Het
Ormdl1 G A 1: 53,305,522 R81K possibly damaging Het
Pcdhb12 G A 18: 37,435,821 V7I possibly damaging Het
Ptprt A G 2: 162,278,226 I107T probably damaging Het
Rbm27 A C 18: 42,301,774 D301A probably damaging Het
Rexo2 A T 9: 48,468,932 I200N probably damaging Het
Rtn4ip1 A T 10: 43,910,871 I192L probably benign Het
Serpinb9e T C 13: 33,255,119 F176S possibly damaging Het
Sorcs3 C A 19: 48,206,736 A186E possibly damaging Het
Spata31 A G 13: 64,922,024 Y662C probably benign Het
Sphkap G A 1: 83,278,898 P377S possibly damaging Het
Srrt T C 5: 137,300,336 K222R probably benign Het
Tas2r129 T C 6: 132,952,036 I312T probably benign Het
Thbs4 G T 13: 92,776,905 P169Q probably benign Het
Tmtc3 T C 10: 100,451,390 M515V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Other mutations in Olfr731
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Olfr731 APN 14 50238138 missense possibly damaging 0.87
IGL02304:Olfr731 APN 14 50238760 missense probably damaging 1.00
IGL02395:Olfr731 APN 14 50238429 missense probably damaging 1.00
IGL03079:Olfr731 APN 14 50238124 missense possibly damaging 0.81
R0646:Olfr731 UTSW 14 50238639 missense probably damaging 1.00
R2027:Olfr731 UTSW 14 50237949 missense probably benign
R2364:Olfr731 UTSW 14 50238155 missense probably damaging 1.00
R4714:Olfr731 UTSW 14 50238367 missense possibly damaging 0.68
R4749:Olfr731 UTSW 14 50238733 missense probably damaging 0.96
R5880:Olfr731 UTSW 14 50238715 missense possibly damaging 0.95
R6954:Olfr731 UTSW 14 50238110 nonsense probably null
R7295:Olfr731 UTSW 14 50238616 missense probably damaging 0.98
R7419:Olfr731 UTSW 14 50237991 missense possibly damaging 0.85
R7457:Olfr731 UTSW 14 50238368 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGATCGCTCCAGTCCTTTCACTGTA -3'
(R):5'- AGCATCTTGGACGGTAGGCTTCCT -3'

Sequencing Primer
(F):5'- CCAGTCCTTTCACTGTATAATGTG -3'
(R):5'- GGTAGGCTTCCTACACACAATG -3'
Posted On2014-01-29