Incidental Mutation 'R1239:Skida1'
ID151866
Institutional Source Beutler Lab
Gene Symbol Skida1
Ensembl Gene ENSMUSG00000054074
Gene NameSKI/DACH domain containing 1
Synonyms
MMRRC Submission 039306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R1239 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location18040676-18049051 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to C at 18047317 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066885] [ENSMUST00000091420] [ENSMUST00000142856] [ENSMUST00000152908]
Predicted Effect unknown
Transcript: ENSMUST00000066885
AA Change: H254Q
SMART Domains Protein: ENSMUSP00000068520
Gene: ENSMUSG00000054074
AA Change: H254Q

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 98 4.1e-19 PFAM
low complexity region 116 130 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 262 279 N/A INTRINSIC
low complexity region 282 297 N/A INTRINSIC
coiled coil region 315 337 N/A INTRINSIC
Pfam:DUF4584 383 820 9.7e-162 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000091420
AA Change: H341Q
SMART Domains Protein: ENSMUSP00000088982
Gene: ENSMUSG00000054074
AA Change: H341Q

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 97 7.7e-17 PFAM
low complexity region 116 130 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
SCOP:d1gkub1 224 254 3e-3 SMART
SCOP:d1gkub1 296 321 6e-3 SMART
low complexity region 349 366 N/A INTRINSIC
low complexity region 369 384 N/A INTRINSIC
coiled coil region 402 424 N/A INTRINSIC
Pfam:DUF4584 471 907 7.7e-179 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142856
SMART Domains Protein: ENSMUSP00000122112
Gene: ENSMUSG00000054074

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 98 4.4e-20 PFAM
low complexity region 116 130 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152908
SMART Domains Protein: ENSMUSP00000114785
Gene: ENSMUSG00000054074

DomainStartEndE-ValueType
Pfam:Ski_Sno 5 65 2.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173604
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik GTTCTTC GTTC 9: 22,424,699 probably benign Het
Actn3 C T 19: 4,865,455 probably benign Het
Adcy8 G T 15: 64,716,062 R959S probably damaging Het
Ank1 A G 8: 23,096,155 N455D probably damaging Het
Ankrd17 T C 5: 90,288,676 T589A probably damaging Het
BC022687 A G 12: 112,809,503 R39G probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Celsr1 G T 15: 85,979,146 N1228K probably damaging Het
Ces4a T C 8: 105,149,498 L557P probably damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Col27a1 T C 4: 63,318,915 probably benign Het
Cplx2 G T 13: 54,379,602 A100S probably damaging Het
Cpsf6 G A 10: 117,361,343 probably benign Het
Cyp1a2 A G 9: 57,681,767 F255L probably benign Het
D10Jhu81e A G 10: 78,168,927 probably benign Het
Dnajc6 T C 4: 101,635,116 Y783H probably damaging Het
E230025N22Rik T C 18: 36,685,475 I434V probably damaging Het
Ermap T C 4: 119,188,925 K3E probably benign Het
Gm14139 T C 2: 150,191,971 Y71H possibly damaging Het
Gstm2 G A 3: 107,984,028 L125F possibly damaging Het
Hk2 C T 6: 82,749,308 G58R probably damaging Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Mgmt T C 7: 137,128,057 F200S probably benign Het
Mug2 T G 6: 122,081,678 probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr1463 G A 19: 13,234,676 C142Y possibly damaging Het
Olfr235 G T 19: 12,268,976 V249F probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Phc3 A G 3: 30,914,130 V886A probably damaging Het
Plcg2 T A 8: 117,556,044 V88D probably benign Het
Podxl2 C T 6: 88,849,983 V50I probably benign Het
Rap1gap G T 4: 137,717,996 M329I probably damaging Het
Rbm5 A G 9: 107,752,966 probably benign Het
Robo1 A G 16: 73,024,542 probably null Het
Ryr2 A T 13: 11,883,043 probably null Het
Tecta A G 9: 42,332,485 F2024L probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Vmn1r16 C T 6: 57,323,633 M1I probably null Het
Zbtb39 G T 10: 127,743,069 G504V probably damaging Het
Zfp106 A T 2: 120,533,594 N777K probably damaging Het
Other mutations in Skida1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02315:Skida1 APN 2 18046005 unclassified probably benign
IGL03220:Skida1 APN 2 18048161 missense probably damaging 1.00
R0328:Skida1 UTSW 2 18047186 unclassified probably benign
R0732:Skida1 UTSW 2 18046157 unclassified probably benign
R1346:Skida1 UTSW 2 18048279 missense possibly damaging 0.92
R1597:Skida1 UTSW 2 18046332 unclassified probably benign
R1867:Skida1 UTSW 2 18046344 unclassified probably benign
R3797:Skida1 UTSW 2 18045897 nonsense probably null
R4521:Skida1 UTSW 2 18045872 unclassified probably benign
R5270:Skida1 UTSW 2 18047649 missense probably benign 0.03
R5467:Skida1 UTSW 2 18046112 unclassified probably benign
R5890:Skida1 UTSW 2 18046003 unclassified probably benign
R7181:Skida1 UTSW 2 18046791 missense unknown
R7398:Skida1 UTSW 2 18046272 missense unknown
R8103:Skida1 UTSW 2 18047738 missense probably benign 0.01
R8199:Skida1 UTSW 2 18048148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTCGGTGGAAGAATCCTCCTC -3'
(R):5'- TGCTGCTGCCCAGATCCTACAAAG -3'

Sequencing Primer
(F):5'- ccccctcttcctcctcc -3'
(R):5'- TCCTACAAAGCCAAggcgg -3'
Posted On2014-01-29