Incidental Mutation 'R1239:Plcg2'
ID151885
Institutional Source Beutler Lab
Gene Symbol Plcg2
Ensembl Gene ENSMUSG00000034330
Gene Namephospholipase C, gamma 2
SynonymsPlcg-2, PLCgamma2
MMRRC Submission 039306-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1239 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location117498291-117635142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117556044 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 88 (V88D)
Ref Sequence ENSEMBL: ENSMUSP00000079991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081232]
PDB Structure
Crystal structure of the N-terminal SH2 domain of mouse phospholipase C-gamma 2 [X-RAY DIFFRACTION]
Solution structure of the SH3 domain from Phospholipase C, gamma 2 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000081232
AA Change: V88D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079991
Gene: ENSMUSG00000034330
AA Change: V88D

DomainStartEndE-ValueType
PH 21 133 1.87e-4 SMART
PLCXc 312 456 2.29e-96 SMART
low complexity region 461 476 N/A INTRINSIC
PDB:2K2J|A 478 516 6e-17 PDB
SH2 530 623 2.24e-30 SMART
SH2 644 726 1.16e-28 SMART
SH3 772 828 3.12e-18 SMART
PH 789 910 4.31e0 SMART
PLCYc 930 1044 1.18e-66 SMART
C2 1062 1167 1.41e-15 SMART
Meta Mutation Damage Score 0.0725 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane signaling enzyme that catalyzes the conversion of 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate to 1D-myo-inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) using calcium as a cofactor. IP3 and DAG are second messenger molecules important for transmitting signals from growth factor receptors and immune system receptors across the cell membrane. Mutations in this gene have been found in autoinflammation, antibody deficiency, and immune dysregulation syndrome and familial cold autoinflammatory syndrome 3. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for some null alleles show decreased B cell and impaired NK cell function. Other homozygous null alleles show aberrant separation of blood and lymphatic vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik GTTCTTC GTTC 9: 22,424,699 probably benign Het
Actn3 C T 19: 4,865,455 probably benign Het
Adcy8 G T 15: 64,716,062 R959S probably damaging Het
Ank1 A G 8: 23,096,155 N455D probably damaging Het
Ankrd17 T C 5: 90,288,676 T589A probably damaging Het
BC022687 A G 12: 112,809,503 R39G probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Celsr1 G T 15: 85,979,146 N1228K probably damaging Het
Ces4a T C 8: 105,149,498 L557P probably damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Col27a1 T C 4: 63,318,915 probably benign Het
Cplx2 G T 13: 54,379,602 A100S probably damaging Het
Cpsf6 G A 10: 117,361,343 probably benign Het
Cyp1a2 A G 9: 57,681,767 F255L probably benign Het
D10Jhu81e A G 10: 78,168,927 probably benign Het
Dnajc6 T C 4: 101,635,116 Y783H probably damaging Het
E230025N22Rik T C 18: 36,685,475 I434V probably damaging Het
Ermap T C 4: 119,188,925 K3E probably benign Het
Gm14139 T C 2: 150,191,971 Y71H possibly damaging Het
Gstm2 G A 3: 107,984,028 L125F possibly damaging Het
Hk2 C T 6: 82,749,308 G58R probably damaging Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Mgmt T C 7: 137,128,057 F200S probably benign Het
Mug2 T G 6: 122,081,678 probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr1463 G A 19: 13,234,676 C142Y possibly damaging Het
Olfr235 G T 19: 12,268,976 V249F probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Phc3 A G 3: 30,914,130 V886A probably damaging Het
Podxl2 C T 6: 88,849,983 V50I probably benign Het
Rap1gap G T 4: 137,717,996 M329I probably damaging Het
Rbm5 A G 9: 107,752,966 probably benign Het
Robo1 A G 16: 73,024,542 probably null Het
Ryr2 A T 13: 11,883,043 probably null Het
Skida1 A C 2: 18,047,317 probably benign Het
Tecta A G 9: 42,332,485 F2024L probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Vmn1r16 C T 6: 57,323,633 M1I probably null Het
Zbtb39 G T 10: 127,743,069 G504V probably damaging Het
Zfp106 A T 2: 120,533,594 N777K probably damaging Het
Other mutations in Plcg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Plcg2 APN 8 117556071 missense possibly damaging 0.89
IGL00911:Plcg2 APN 8 117586515 missense probably benign 0.17
IGL00952:Plcg2 APN 8 117607217 missense probably benign
IGL01115:Plcg2 APN 8 117557329 missense probably damaging 1.00
IGL01326:Plcg2 APN 8 117573999 splice site probably benign
IGL01357:Plcg2 APN 8 117614161 splice site probably benign
IGL01705:Plcg2 APN 8 117581662 missense probably damaging 1.00
IGL01755:Plcg2 APN 8 117621241 missense possibly damaging 0.48
IGL01828:Plcg2 APN 8 117590233 missense probably damaging 1.00
IGL02307:Plcg2 APN 8 117579896 critical splice donor site probably null
IGL02345:Plcg2 APN 8 117585180 missense probably damaging 0.99
IGL02448:Plcg2 APN 8 117607221 missense probably benign
IGL02587:Plcg2 APN 8 117558113 missense possibly damaging 0.80
IGL02646:Plcg2 APN 8 117603883 missense possibly damaging 0.88
IGL03409:Plcg2 APN 8 117583495 missense probably damaging 0.96
Poseidon UTSW 8 117615238 missense probably damaging 1.00
Poseidon2 UTSW 8 117577874 missense possibly damaging 0.80
queen UTSW 8 117581707 missense probably benign 0.00
Seahorse UTSW 8 117589835 splice site probably null
Teleost UTSW 8 117583549 missense probably damaging 1.00
Theseus UTSW 8 117596332 missense probably damaging 0.99
trident UTSW 8 117612978 missense probably benign 0.00
R0172:Plcg2 UTSW 8 117579782 missense probably benign 0.00
R0194:Plcg2 UTSW 8 117573397 splice site probably benign
R0410:Plcg2 UTSW 8 117615373 missense probably damaging 0.98
R0462:Plcg2 UTSW 8 117585305 missense probably benign 0.06
R0494:Plcg2 UTSW 8 117556104 missense probably damaging 1.00
R0522:Plcg2 UTSW 8 117614288 splice site probably null
R0612:Plcg2 UTSW 8 117573365 missense probably benign 0.01
R1367:Plcg2 UTSW 8 117615238 missense probably damaging 1.00
R1608:Plcg2 UTSW 8 117614235 missense possibly damaging 0.89
R1756:Plcg2 UTSW 8 117592708 missense probably benign 0.02
R2176:Plcg2 UTSW 8 117612994 missense probably damaging 1.00
R3500:Plcg2 UTSW 8 117612978 missense probably benign 0.00
R4043:Plcg2 UTSW 8 117612978 missense probably benign 0.00
R4654:Plcg2 UTSW 8 117504315 missense probably benign
R4883:Plcg2 UTSW 8 117607133 nonsense probably null
R4932:Plcg2 UTSW 8 117607083 missense probably benign 0.05
R5080:Plcg2 UTSW 8 117590003 missense probably benign 0.10
R5226:Plcg2 UTSW 8 117577874 missense possibly damaging 0.80
R5264:Plcg2 UTSW 8 117634793 missense possibly damaging 0.95
R5298:Plcg2 UTSW 8 117605249 missense probably benign
R5473:Plcg2 UTSW 8 117634401 missense probably benign
R5555:Plcg2 UTSW 8 117612995 nonsense probably null
R5557:Plcg2 UTSW 8 117586557 missense probably damaging 0.99
R5805:Plcg2 UTSW 8 117598495 critical splice donor site probably null
R5826:Plcg2 UTSW 8 117610844 missense probably benign 0.19
R5871:Plcg2 UTSW 8 117504217 missense probably damaging 1.00
R5894:Plcg2 UTSW 8 117504349 missense probably damaging 0.99
R6142:Plcg2 UTSW 8 117585271 missense probably benign
R6609:Plcg2 UTSW 8 117568170 missense probably benign 0.31
R6684:Plcg2 UTSW 8 117596332 missense probably damaging 0.99
R6710:Plcg2 UTSW 8 117557347 missense probably benign 0.05
R6931:Plcg2 UTSW 8 117557319 missense probably benign 0.24
R6946:Plcg2 UTSW 8 117504190 missense probably benign
R7036:Plcg2 UTSW 8 117596306 missense probably benign
R7070:Plcg2 UTSW 8 117596306 missense probably benign
R7072:Plcg2 UTSW 8 117589835 splice site probably null
R7214:Plcg2 UTSW 8 117583549 missense probably damaging 1.00
R7351:Plcg2 UTSW 8 117590310 missense possibly damaging 0.95
R7393:Plcg2 UTSW 8 117579825 missense possibly damaging 0.90
R7443:Plcg2 UTSW 8 117504289 missense probably benign 0.00
R7513:Plcg2 UTSW 8 117579853 missense probably damaging 0.99
R7609:Plcg2 UTSW 8 117558113 missense probably benign 0.01
X0027:Plcg2 UTSW 8 117555983 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCACACTCAGGAGAATTGGACCC -3'
(R):5'- ACTCTCAACTTGAGCCAGGCAGAC -3'

Sequencing Primer
(F):5'- GTCAGAGATGGACTCACAGC -3'
(R):5'- gccacatcgctgtcccc -3'
Posted On2014-01-29