Incidental Mutation 'R1239:Rbm5'
ID151890
Institutional Source Beutler Lab
Gene Symbol Rbm5
Ensembl Gene ENSMUSG00000032580
Gene NameRNA binding motif protein 5
SynonymsD030069N10Rik
MMRRC Submission 039306-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R1239 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107740371-107770996 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 107752966 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000035199] [ENSMUST00000182304] [ENSMUST00000182371] [ENSMUST00000182421] [ENSMUST00000182659] [ENSMUST00000192130]
Predicted Effect probably benign
Transcript: ENSMUST00000035199
SMART Domains Protein: ENSMUSP00000035199
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
RRM 99 174 5.98e-13 SMART
ZnF_RBZ 183 207 1.53e-6 SMART
RRM 232 311 9.5e-7 SMART
low complexity region 329 355 N/A INTRINSIC
low complexity region 362 385 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
low complexity region 425 446 N/A INTRINSIC
Blast:RRM_2 483 506 1e-5 BLAST
low complexity region 520 536 N/A INTRINSIC
low complexity region 569 581 N/A INTRINSIC
low complexity region 627 641 N/A INTRINSIC
ZnF_C2H2 647 672 5.2e0 SMART
coiled coil region 673 707 N/A INTRINSIC
G_patch 741 787 1.85e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182304
SMART Domains Protein: ENSMUSP00000138380
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
RRM 99 174 5.98e-13 SMART
ZnF_RBZ 183 207 1.53e-6 SMART
PDB:2LKZ|A 231 251 5e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182332
Predicted Effect probably benign
Transcript: ENSMUST00000182371
SMART Domains Protein: ENSMUSP00000138119
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
SCOP:d1h6kx_ 96 138 6e-3 SMART
Blast:RRM 99 136 3e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000182421
SMART Domains Protein: ENSMUSP00000138778
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 59 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182422
Predicted Effect probably benign
Transcript: ENSMUST00000182659
SMART Domains Protein: ENSMUSP00000138379
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
RRM 99 174 5.98e-13 SMART
ZnF_RBZ 183 207 1.53e-6 SMART
RRM 232 311 9.5e-7 SMART
low complexity region 329 355 N/A INTRINSIC
low complexity region 362 385 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
low complexity region 425 446 N/A INTRINSIC
Blast:RRM_2 483 506 1e-5 BLAST
low complexity region 520 536 N/A INTRINSIC
low complexity region 569 581 N/A INTRINSIC
low complexity region 627 641 N/A INTRINSIC
ZnF_C2H2 647 672 5.2e0 SMART
coiled coil region 673 707 N/A INTRINSIC
G_patch 741 787 1.85e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183307
Predicted Effect probably benign
Transcript: ENSMUST00000192130
SMART Domains Protein: ENSMUSP00000142194
Gene: ENSMUSG00000032580

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
SCOP:d1h6kx_ 96 138 6e-3 SMART
Blast:RRM 99 136 3e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193342
Predicted Effect probably benign
Transcript: ENSMUST00000194400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194801
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate tumor suppressor gene which encodes a nuclear RNA binding protein that is a component of the spliceosome A complex. The encoded protein plays a role in the induction of cell cycle arrest and apoptosis through pre-mRNA splicing of multiple target genes including the tumor suppressor protein p53. This gene is located within the tumor suppressor region 3p21.3, and may play a role in the inhibition of tumor transformation and progression of several malignancies including lung cancer. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility with azoospermia, male germ cell apoptosis, round spermatid arrest and spermatid differentiation arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik GTTCTTC GTTC 9: 22,424,699 probably benign Het
Actn3 C T 19: 4,865,455 probably benign Het
Adcy8 G T 15: 64,716,062 R959S probably damaging Het
Ank1 A G 8: 23,096,155 N455D probably damaging Het
Ankrd17 T C 5: 90,288,676 T589A probably damaging Het
BC022687 A G 12: 112,809,503 R39G probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Celsr1 G T 15: 85,979,146 N1228K probably damaging Het
Ces4a T C 8: 105,149,498 L557P probably damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Col27a1 T C 4: 63,318,915 probably benign Het
Cplx2 G T 13: 54,379,602 A100S probably damaging Het
Cpsf6 G A 10: 117,361,343 probably benign Het
Cyp1a2 A G 9: 57,681,767 F255L probably benign Het
D10Jhu81e A G 10: 78,168,927 probably benign Het
Dnajc6 T C 4: 101,635,116 Y783H probably damaging Het
E230025N22Rik T C 18: 36,685,475 I434V probably damaging Het
Ermap T C 4: 119,188,925 K3E probably benign Het
Gm14139 T C 2: 150,191,971 Y71H possibly damaging Het
Gstm2 G A 3: 107,984,028 L125F possibly damaging Het
Hk2 C T 6: 82,749,308 G58R probably damaging Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Mgmt T C 7: 137,128,057 F200S probably benign Het
Mug2 T G 6: 122,081,678 probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr1463 G A 19: 13,234,676 C142Y possibly damaging Het
Olfr235 G T 19: 12,268,976 V249F probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Phc3 A G 3: 30,914,130 V886A probably damaging Het
Plcg2 T A 8: 117,556,044 V88D probably benign Het
Podxl2 C T 6: 88,849,983 V50I probably benign Het
Rap1gap G T 4: 137,717,996 M329I probably damaging Het
Robo1 A G 16: 73,024,542 probably null Het
Ryr2 A T 13: 11,883,043 probably null Het
Skida1 A C 2: 18,047,317 probably benign Het
Tecta A G 9: 42,332,485 F2024L probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Vmn1r16 C T 6: 57,323,633 M1I probably null Het
Zbtb39 G T 10: 127,743,069 G504V probably damaging Het
Zfp106 A T 2: 120,533,594 N777K probably damaging Het
Other mutations in Rbm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02041:Rbm5 APN 9 107755846 unclassified probably benign
IGL02319:Rbm5 APN 9 107743865 nonsense probably null
IGL02567:Rbm5 APN 9 107744274 missense probably damaging 1.00
IGL02868:Rbm5 APN 9 107749700 splice site probably benign
IGL02943:Rbm5 APN 9 107744343 missense probably damaging 1.00
IGL02959:Rbm5 APN 9 107754185 unclassified probably benign
IGL03029:Rbm5 APN 9 107754453 missense possibly damaging 0.46
PIT4403001:Rbm5 UTSW 9 107760336 missense probably damaging 1.00
R0001:Rbm5 UTSW 9 107742424 missense probably damaging 1.00
R0242:Rbm5 UTSW 9 107751708 splice site probably benign
R1170:Rbm5 UTSW 9 107742497 missense probably damaging 0.99
R1297:Rbm5 UTSW 9 107744242 missense probably damaging 1.00
R1719:Rbm5 UTSW 9 107743913 critical splice acceptor site probably null
R1764:Rbm5 UTSW 9 107767564 nonsense probably null
R1826:Rbm5 UTSW 9 107742414 missense probably damaging 0.98
R1863:Rbm5 UTSW 9 107750519 missense possibly damaging 0.70
R4112:Rbm5 UTSW 9 107765597 missense probably damaging 1.00
R4207:Rbm5 UTSW 9 107750483 missense probably benign
R4343:Rbm5 UTSW 9 107752196 missense probably damaging 1.00
R4441:Rbm5 UTSW 9 107749688 intron probably benign
R4621:Rbm5 UTSW 9 107754146 missense probably damaging 1.00
R4767:Rbm5 UTSW 9 107745213 missense probably damaging 1.00
R5090:Rbm5 UTSW 9 107760312 splice site probably benign
R5404:Rbm5 UTSW 9 107765553 missense probably damaging 1.00
R5876:Rbm5 UTSW 9 107760326 missense probably damaging 1.00
R5959:Rbm5 UTSW 9 107752140 missense probably benign 0.02
R5983:Rbm5 UTSW 9 107744942 missense probably damaging 1.00
R5984:Rbm5 UTSW 9 107744942 missense probably damaging 1.00
R7436:Rbm5 UTSW 9 107750394 intron probably null
R7447:Rbm5 UTSW 9 107746179 missense probably damaging 1.00
R7867:Rbm5 UTSW 9 107751731 missense probably benign 0.02
R7950:Rbm5 UTSW 9 107751731 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGAGGACTGGAAGGTTAAGCCCTA -3'
(R):5'- TCTCAGACTTTATGTCCAGAAGCAGGT -3'

Sequencing Primer
(F):5'- GGTTAAGCCCTAAGAGAAGATGAC -3'
(R):5'- tctttcttcctttcttcctttcttc -3'
Posted On2014-01-29