Incidental Mutation 'R1240:Cenpc1'
ID151927
Institutional Source Beutler Lab
Gene Symbol Cenpc1
Ensembl Gene ENSMUSG00000029253
Gene Namecentromere protein C1
Synonyms
MMRRC Submission 039307-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1240 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location86012024-86065583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86035510 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 473 (N473K)
Ref Sequence ENSEMBL: ENSMUSP00000031170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031170]
Predicted Effect probably benign
Transcript: ENSMUST00000031170
AA Change: N473K

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031170
Gene: ENSMUSG00000029253
AA Change: N473K

DomainStartEndE-ValueType
Pfam:CENP_C_N 7 121 6.1e-42 PFAM
Pfam:CENP_C_N 115 261 2.6e-46 PFAM
Pfam:CENP-C_mid 265 519 5.4e-100 PFAM
PDB:4INM|W 700 724 5e-9 PDB
Pfam:CENP-C_C 819 903 3.9e-28 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a centromeric protein component of a nucleosome-associated complex that plays a central role in kinetochore protein assembly, mitotic progression and chromosome segregation. The human ortholog encodes a protein with DNA-binding activity, that associates constitutively to kinetochores throughout the cell cycle, as part of a prekinetochore complex, together with centromeric protein-A and centromeric protein-B. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T G 5: 124,089,921 I86L probably benign Het
Ankfn1 A G 11: 89,392,134 L229P probably damaging Het
Aoc1 T C 6: 48,905,615 S164P probably benign Het
Arhgef28 C T 13: 97,929,492 V1618I probably benign Het
Arpc3 T C 5: 122,404,179 F88S probably damaging Het
Asgr2 G T 11: 70,096,850 R58L possibly damaging Het
Bach2 T C 4: 32,563,198 F432S probably damaging Het
Brms1l C A 12: 55,844,508 R116S probably damaging Het
Casp2 T A 6: 42,268,945 C179S probably damaging Het
Ccdc73 A T 2: 104,991,561 E618D probably benign Het
Cdh6 T A 15: 13,057,455 D260V possibly damaging Het
Chst2 T C 9: 95,405,483 E270G possibly damaging Het
Chst9 C T 18: 15,453,174 E111K probably benign Het
Cyp3a44 T G 5: 145,774,440 I474L probably benign Het
Dbr1 G T 9: 99,584,020 E550D probably benign Het
Dirc2 A G 16: 35,698,009 F445L probably benign Het
Dph6 T C 2: 114,644,718 probably null Het
Fam227b T A 2: 126,124,585 I136L possibly damaging Het
Fam46b T C 4: 133,486,504 F229L probably benign Het
Fcgbp A G 7: 28,120,525 N2559S probably damaging Het
Fh1 A T 1: 175,604,015 I435N probably damaging Het
Gab1 A C 8: 80,788,530 S386R probably damaging Het
Gkn1 T A 6: 87,349,116 N31Y probably damaging Het
Grk2 A G 19: 4,290,679 C251R probably damaging Het
H2-DMa G T 17: 34,138,406 probably null Het
Hp1bp3 T C 4: 138,229,698 S63P probably damaging Het
Ift74 A G 4: 94,692,937 probably null Het
Inf2 G A 12: 112,610,776 R1018Q unknown Het
Kat2b A G 17: 53,624,397 D141G probably benign Het
Klhl30 T C 1: 91,361,015 S499P probably benign Het
Lama2 A C 10: 27,041,124 D2268E probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Marf1 T C 16: 14,146,762 N258S possibly damaging Het
Mc1r T A 8: 123,408,260 C251S probably damaging Het
Myo15b C A 11: 115,880,501 Q257K possibly damaging Het
Nbeal2 A G 9: 110,627,108 F2431S probably damaging Het
Neb T A 2: 52,296,309 H917L possibly damaging Het
Nlrp1a A G 11: 71,113,466 probably null Het
Nr1d2 A T 14: 18,211,891 M404K probably benign Het
Olfr32 T G 2: 90,138,813 I109L possibly damaging Het
Olfr52 T G 2: 86,182,109 M1L possibly damaging Het
Otoa T C 7: 121,156,490 S1040P probably benign Het
Pctp T C 11: 90,002,814 D10G probably benign Het
Pja2 G T 17: 64,309,618 T94K probably benign Het
Plxna1 C T 6: 89,321,050 V1749M probably damaging Het
Prdm15 C T 16: 97,837,600 E87K probably damaging Het
Rgsl1 A G 1: 153,785,191 F1028L probably benign Het
Sepsecs T C 5: 52,660,679 N252S probably damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc22a22 G A 15: 57,250,872 S353F probably benign Het
Slc7a13 A T 4: 19,819,212 K137N probably damaging Het
Snx13 G T 12: 35,091,406 V163L probably damaging Het
Synrg A T 11: 84,023,356 T1115S probably damaging Het
Tenm3 A G 8: 48,287,893 V1185A possibly damaging Het
Tg T A 15: 66,828,548 N118K probably benign Het
Top1mt T C 15: 75,670,067 K153E probably damaging Het
Trmt11 T C 10: 30,590,825 probably benign Het
Unc80 A G 1: 66,635,902 D1953G possibly damaging Het
Vmn2r25 T A 6: 123,851,905 S137C probably damaging Het
Vwf C A 6: 125,603,308 probably null Het
Other mutations in Cenpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Cenpc1 APN 5 86037528 missense probably benign 0.02
IGL01287:Cenpc1 APN 5 86022454 nonsense probably null
IGL01363:Cenpc1 APN 5 86046531 nonsense probably null
IGL01720:Cenpc1 APN 5 86045425 missense possibly damaging 0.84
IGL02217:Cenpc1 APN 5 86029200 splice site probably benign
IGL02665:Cenpc1 APN 5 86046403 missense probably benign 0.01
IGL03022:Cenpc1 APN 5 86022375 splice site probably benign
IGL03162:Cenpc1 APN 5 86037905 missense possibly damaging 0.94
IGL03343:Cenpc1 APN 5 86016322 missense probably damaging 0.96
R0130:Cenpc1 UTSW 5 86046546 missense probably benign 0.07
R0193:Cenpc1 UTSW 5 86032403 missense probably benign 0.30
R0314:Cenpc1 UTSW 5 86037371 missense probably benign 0.20
R0932:Cenpc1 UTSW 5 86037600 missense possibly damaging 0.94
R0973:Cenpc1 UTSW 5 86037908 missense probably damaging 1.00
R0973:Cenpc1 UTSW 5 86037908 missense probably damaging 1.00
R0974:Cenpc1 UTSW 5 86037908 missense probably damaging 1.00
R1454:Cenpc1 UTSW 5 86013510 missense possibly damaging 0.71
R1677:Cenpc1 UTSW 5 86061998 splice site probably benign
R2044:Cenpc1 UTSW 5 86037755 missense probably benign 0.01
R2256:Cenpc1 UTSW 5 86016203 missense probably damaging 1.00
R3085:Cenpc1 UTSW 5 86037617 missense probably benign 0.01
R4516:Cenpc1 UTSW 5 86047587 missense possibly damaging 0.72
R4518:Cenpc1 UTSW 5 86047587 missense possibly damaging 0.72
R4561:Cenpc1 UTSW 5 86047632 missense probably damaging 1.00
R4827:Cenpc1 UTSW 5 86034431 missense possibly damaging 0.67
R4864:Cenpc1 UTSW 5 86045321 missense probably damaging 1.00
R5222:Cenpc1 UTSW 5 86037747 missense possibly damaging 0.77
R5707:Cenpc1 UTSW 5 86035434 missense possibly damaging 0.82
R5920:Cenpc1 UTSW 5 86020910 missense probably benign 0.00
R5999:Cenpc1 UTSW 5 86012263 missense probably damaging 1.00
R6073:Cenpc1 UTSW 5 86058153 critical splice donor site probably null
R6209:Cenpc1 UTSW 5 86033650 missense probably benign 0.02
R6244:Cenpc1 UTSW 5 86046385 missense probably damaging 1.00
R6278:Cenpc1 UTSW 5 86035535 missense probably damaging 0.97
R6395:Cenpc1 UTSW 5 86035570 missense probably benign 0.14
R7269:Cenpc1 UTSW 5 86013507 missense probably damaging 1.00
R7269:Cenpc1 UTSW 5 86032418 missense probably benign 0.12
R7335:Cenpc1 UTSW 5 86034353 missense possibly damaging 0.95
R7378:Cenpc1 UTSW 5 86046499 missense probably benign 0.02
R7968:Cenpc1 UTSW 5 86033692 missense probably benign
R8380:Cenpc1 UTSW 5 86046416 missense probably benign 0.00
RF018:Cenpc1 UTSW 5 86045369 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGGACTTTTGACTTTGTCCACAGCAC -3'
(R):5'- TGAATGCACAGGTACACACATTCCTC -3'

Sequencing Primer
(F):5'- TGTCTACATACAGAGCACTGG -3'
(R):5'- ACAGGTACACACATTCCTCTTTTAG -3'
Posted On2014-01-29