Incidental Mutation 'R1240:Casp2'
ID 151931
Institutional Source Beutler Lab
Gene Symbol Casp2
Ensembl Gene ENSMUSG00000029863
Gene Name caspase 2
Synonyms Nedd2, Ich-1, Caspase-2
MMRRC Submission 039307-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.354) question?
Stock # R1240 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 42241942-42259442 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 42245879 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 179 (C179S)
Ref Sequence ENSEMBL: ENSMUSP00000121184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031895] [ENSMUST00000095987] [ENSMUST00000156829]
AlphaFold P29594
Predicted Effect possibly damaging
Transcript: ENSMUST00000031895
AA Change: C179S

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031895
Gene: ENSMUSG00000029863
AA Change: C179S

DomainStartEndE-ValueType
CARD 32 120 2.27e-32 SMART
CASc 191 447 3.27e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095987
SMART Domains Protein: ENSMUSP00000100590
Gene: ENSMUSG00000071506

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:TMEM51 58 194 1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144821
Predicted Effect probably damaging
Transcript: ENSMUST00000156829
AA Change: C179S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121184
Gene: ENSMUSG00000029863
AA Change: C179S

DomainStartEndE-ValueType
CARD 32 120 2.27e-32 SMART
CASc 191 341 8.07e-38 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the evolutionarily ancient and most conserved member of the cysteine proteases that plays important role in stress-induced apoptosis, DNA repair and tumor suppression. Mice lacking the encoded protein develop normally but display cell type-specific apoptotic defects. Germ cells and oocytes from such mice were found to be resistant to cell death after treatment with chemotherapeutic drugs. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in abnormal apoptosis. Apoptosis is reduced in the female germline, but is increased in sympathetic neurons during development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T G 5: 124,227,984 (GRCm39) I86L probably benign Het
Ankfn1 A G 11: 89,282,960 (GRCm39) L229P probably damaging Het
Aoc1 T C 6: 48,882,549 (GRCm39) S164P probably benign Het
Arhgef28 C T 13: 98,066,000 (GRCm39) V1618I probably benign Het
Arpc3 T C 5: 122,542,242 (GRCm39) F88S probably damaging Het
Asgr2 G T 11: 69,987,676 (GRCm39) R58L possibly damaging Het
Bach2 T C 4: 32,563,198 (GRCm39) F432S probably damaging Het
Brms1l C A 12: 55,891,293 (GRCm39) R116S probably damaging Het
Ccdc73 A T 2: 104,821,906 (GRCm39) E618D probably benign Het
Cdh6 T A 15: 13,057,541 (GRCm39) D260V possibly damaging Het
Cenpc1 G T 5: 86,183,369 (GRCm39) N473K probably benign Het
Chst2 T C 9: 95,287,536 (GRCm39) E270G possibly damaging Het
Chst9 C T 18: 15,586,231 (GRCm39) E111K probably benign Het
Cyp3a44 T G 5: 145,711,250 (GRCm39) I474L probably benign Het
Dbr1 G T 9: 99,466,073 (GRCm39) E550D probably benign Het
Dph6 T C 2: 114,475,199 (GRCm39) probably null Het
Fam227b T A 2: 125,966,505 (GRCm39) I136L possibly damaging Het
Fcgbp A G 7: 27,819,950 (GRCm39) N2559S probably damaging Het
Fh1 A T 1: 175,431,581 (GRCm39) I435N probably damaging Het
Gab1 A C 8: 81,515,159 (GRCm39) S386R probably damaging Het
Gkn1 T A 6: 87,326,098 (GRCm39) N31Y probably damaging Het
Grk2 A G 19: 4,340,707 (GRCm39) C251R probably damaging Het
H2-DMa G T 17: 34,357,380 (GRCm39) probably null Het
Hp1bp3 T C 4: 137,957,009 (GRCm39) S63P probably damaging Het
Ift74 A G 4: 94,581,174 (GRCm39) probably null Het
Inf2 G A 12: 112,577,210 (GRCm39) R1018Q unknown Het
Kat2b A G 17: 53,931,425 (GRCm39) D141G probably benign Het
Klhl30 T C 1: 91,288,737 (GRCm39) S499P probably benign Het
Lama2 A C 10: 26,917,120 (GRCm39) D2268E probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,235,260 (GRCm39) probably null Het
Marf1 T C 16: 13,964,626 (GRCm39) N258S possibly damaging Het
Mc1r T A 8: 124,134,999 (GRCm39) C251S probably damaging Het
Myo15b C A 11: 115,771,327 (GRCm39) Q257K possibly damaging Het
Nbeal2 A G 9: 110,456,176 (GRCm39) F2431S probably damaging Het
Neb T A 2: 52,186,321 (GRCm39) H917L possibly damaging Het
Nlrp1a A G 11: 71,004,292 (GRCm39) probably null Het
Nr1d2 A T 14: 18,211,891 (GRCm38) M404K probably benign Het
Or4b1d T G 2: 89,969,157 (GRCm39) I109L possibly damaging Het
Or8u8 T G 2: 86,012,453 (GRCm39) M1L possibly damaging Het
Otoa T C 7: 120,755,713 (GRCm39) S1040P probably benign Het
Pctp T C 11: 89,893,640 (GRCm39) D10G probably benign Het
Pja2 G T 17: 64,616,613 (GRCm39) T94K probably benign Het
Plxna1 C T 6: 89,298,032 (GRCm39) V1749M probably damaging Het
Prdm15 C T 16: 97,638,800 (GRCm39) E87K probably damaging Het
Rgsl1 A G 1: 153,660,937 (GRCm39) F1028L probably benign Het
Sepsecs T C 5: 52,818,021 (GRCm39) N252S probably damaging Het
Skint5 A T 4: 113,574,304 (GRCm39) L749Q unknown Het
Slc22a22 G A 15: 57,114,268 (GRCm39) S353F probably benign Het
Slc49a4 A G 16: 35,518,379 (GRCm39) F445L probably benign Het
Slc7a13 A T 4: 19,819,212 (GRCm39) K137N probably damaging Het
Snx13 G T 12: 35,141,405 (GRCm39) V163L probably damaging Het
Synrg A T 11: 83,914,182 (GRCm39) T1115S probably damaging Het
Tenm3 A G 8: 48,740,928 (GRCm39) V1185A possibly damaging Het
Tent5b T C 4: 133,213,815 (GRCm39) F229L probably benign Het
Tg T A 15: 66,700,397 (GRCm39) N118K probably benign Het
Top1mt T C 15: 75,541,916 (GRCm39) K153E probably damaging Het
Trmt11 T C 10: 30,466,821 (GRCm39) probably benign Het
Unc80 A G 1: 66,675,061 (GRCm39) D1953G possibly damaging Het
Vmn2r25 T A 6: 123,828,864 (GRCm39) S137C probably damaging Het
Vwf C A 6: 125,580,271 (GRCm39) probably null Het
Other mutations in Casp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Casp2 APN 6 42,246,219 (GRCm39) nonsense probably null
IGL02094:Casp2 APN 6 42,257,293 (GRCm39) missense probably damaging 1.00
IGL02371:Casp2 APN 6 42,244,902 (GRCm39) missense probably benign 0.00
IGL02414:Casp2 APN 6 42,257,380 (GRCm39) missense probably damaging 1.00
IGL03298:Casp2 APN 6 42,245,924 (GRCm39) splice site probably benign
R1424:Casp2 UTSW 6 42,253,725 (GRCm39) splice site probably benign
R1672:Casp2 UTSW 6 42,245,842 (GRCm39) missense probably damaging 1.00
R4110:Casp2 UTSW 6 42,244,828 (GRCm39) missense probably damaging 1.00
R4113:Casp2 UTSW 6 42,244,828 (GRCm39) missense probably damaging 1.00
R5062:Casp2 UTSW 6 42,246,206 (GRCm39) splice site probably benign
R5469:Casp2 UTSW 6 42,246,268 (GRCm39) missense probably benign 0.00
R5835:Casp2 UTSW 6 42,244,520 (GRCm39) missense possibly damaging 0.84
R5877:Casp2 UTSW 6 42,253,571 (GRCm39) intron probably benign
R6103:Casp2 UTSW 6 42,256,814 (GRCm39) missense probably damaging 0.99
R6667:Casp2 UTSW 6 42,256,770 (GRCm39) missense probably damaging 1.00
R6702:Casp2 UTSW 6 42,244,985 (GRCm39) missense probably benign
R6754:Casp2 UTSW 6 42,246,264 (GRCm39) missense probably damaging 1.00
R7141:Casp2 UTSW 6 42,257,329 (GRCm39) missense possibly damaging 0.68
R7255:Casp2 UTSW 6 42,245,841 (GRCm39) missense probably damaging 1.00
R7611:Casp2 UTSW 6 42,250,972 (GRCm39) missense possibly damaging 0.95
R9135:Casp2 UTSW 6 42,245,882 (GRCm39) missense probably benign 0.03
R9350:Casp2 UTSW 6 42,246,332 (GRCm39) missense probably benign 0.15
X0065:Casp2 UTSW 6 42,257,077 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAGCCAACAGGGTCTGTGCAAG -3'
(R):5'- ACAGGCAATGTCGTTACCCTACAAG -3'

Sequencing Primer
(F):5'- CTGTGCAAGCGTTGAGC -3'
(R):5'- AAGACCAGGAAAGCCTCTCA -3'
Posted On 2014-01-29