Incidental Mutation 'R1240:Brms1l'
ID151953
Institutional Source Beutler Lab
Gene Symbol Brms1l
Ensembl Gene ENSMUSG00000012076
Gene Namebreast cancer metastasis-suppressor 1-like
SynonymsD12Ertd407e, BRMS1, 0710008O11Rik
MMRRC Submission 039307-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R1240 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location55836324-55869736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 55844508 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 116 (R116S)
Ref Sequence ENSEMBL: ENSMUSP00000151316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059250] [ENSMUST00000219419]
Predicted Effect probably damaging
Transcript: ENSMUST00000059250
AA Change: R116S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082500
Gene: ENSMUSG00000012076
AA Change: R116S

DomainStartEndE-ValueType
low complexity region 24 55 N/A INTRINSIC
Pfam:Sds3 61 217 1.5e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219337
Predicted Effect probably damaging
Transcript: ENSMUST00000219419
AA Change: R116S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220400
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shows sequence similarity to the human breast carcinoma metastasis suppressor (BRMS1) protein and the mammalian Sds3 (suppressor of defective silencing 3) proteins. This protein is a component of the mSin3a family of histone deacetylase complexes (HDAC). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T G 5: 124,089,921 I86L probably benign Het
Ankfn1 A G 11: 89,392,134 L229P probably damaging Het
Aoc1 T C 6: 48,905,615 S164P probably benign Het
Arhgef28 C T 13: 97,929,492 V1618I probably benign Het
Arpc3 T C 5: 122,404,179 F88S probably damaging Het
Asgr2 G T 11: 70,096,850 R58L possibly damaging Het
Bach2 T C 4: 32,563,198 F432S probably damaging Het
Casp2 T A 6: 42,268,945 C179S probably damaging Het
Ccdc73 A T 2: 104,991,561 E618D probably benign Het
Cdh6 T A 15: 13,057,455 D260V possibly damaging Het
Cenpc1 G T 5: 86,035,510 N473K probably benign Het
Chst2 T C 9: 95,405,483 E270G possibly damaging Het
Chst9 C T 18: 15,453,174 E111K probably benign Het
Cyp3a44 T G 5: 145,774,440 I474L probably benign Het
Dbr1 G T 9: 99,584,020 E550D probably benign Het
Dirc2 A G 16: 35,698,009 F445L probably benign Het
Dph6 T C 2: 114,644,718 probably null Het
Fam227b T A 2: 126,124,585 I136L possibly damaging Het
Fam46b T C 4: 133,486,504 F229L probably benign Het
Fcgbp A G 7: 28,120,525 N2559S probably damaging Het
Fh1 A T 1: 175,604,015 I435N probably damaging Het
Gab1 A C 8: 80,788,530 S386R probably damaging Het
Gkn1 T A 6: 87,349,116 N31Y probably damaging Het
Grk2 A G 19: 4,290,679 C251R probably damaging Het
H2-DMa G T 17: 34,138,406 probably null Het
Hp1bp3 T C 4: 138,229,698 S63P probably damaging Het
Ift74 A G 4: 94,692,937 probably null Het
Inf2 G A 12: 112,610,776 R1018Q unknown Het
Kat2b A G 17: 53,624,397 D141G probably benign Het
Klhl30 T C 1: 91,361,015 S499P probably benign Het
Lama2 A C 10: 27,041,124 D2268E probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Marf1 T C 16: 14,146,762 N258S possibly damaging Het
Mc1r T A 8: 123,408,260 C251S probably damaging Het
Myo15b C A 11: 115,880,501 Q257K possibly damaging Het
Nbeal2 A G 9: 110,627,108 F2431S probably damaging Het
Neb T A 2: 52,296,309 H917L possibly damaging Het
Nlrp1a A G 11: 71,113,466 probably null Het
Nr1d2 A T 14: 18,211,891 M404K probably benign Het
Olfr32 T G 2: 90,138,813 I109L possibly damaging Het
Olfr52 T G 2: 86,182,109 M1L possibly damaging Het
Otoa T C 7: 121,156,490 S1040P probably benign Het
Pctp T C 11: 90,002,814 D10G probably benign Het
Pja2 G T 17: 64,309,618 T94K probably benign Het
Plxna1 C T 6: 89,321,050 V1749M probably damaging Het
Prdm15 C T 16: 97,837,600 E87K probably damaging Het
Rgsl1 A G 1: 153,785,191 F1028L probably benign Het
Sepsecs T C 5: 52,660,679 N252S probably damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc22a22 G A 15: 57,250,872 S353F probably benign Het
Slc7a13 A T 4: 19,819,212 K137N probably damaging Het
Snx13 G T 12: 35,091,406 V163L probably damaging Het
Synrg A T 11: 84,023,356 T1115S probably damaging Het
Tenm3 A G 8: 48,287,893 V1185A possibly damaging Het
Tg T A 15: 66,828,548 N118K probably benign Het
Top1mt T C 15: 75,670,067 K153E probably damaging Het
Trmt11 T C 10: 30,590,825 probably benign Het
Unc80 A G 1: 66,635,902 D1953G possibly damaging Het
Vmn2r25 T A 6: 123,851,905 S137C probably damaging Het
Vwf C A 6: 125,603,308 probably null Het
Other mutations in Brms1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Brms1l APN 12 55845326 missense probably benign 0.15
IGL00951:Brms1l APN 12 55866049 missense possibly damaging 0.54
IGL02199:Brms1l APN 12 55861172 critical splice donor site probably benign
IGL02669:Brms1l APN 12 55841616 missense probably damaging 1.00
IGL03158:Brms1l APN 12 55836535 missense possibly damaging 0.83
IGL03184:Brms1l APN 12 55868277 makesense probably null
R0445:Brms1l UTSW 12 55861406 nonsense probably null
R0568:Brms1l UTSW 12 55861388 critical splice acceptor site probably null
R0942:Brms1l UTSW 12 55865957 missense probably benign 0.00
R0968:Brms1l UTSW 12 55866013 missense possibly damaging 0.73
R1580:Brms1l UTSW 12 55868222 missense probably damaging 1.00
R1694:Brms1l UTSW 12 55841600 missense probably damaging 1.00
R1926:Brms1l UTSW 12 55863161 missense possibly damaging 0.69
R4626:Brms1l UTSW 12 55863173 missense probably benign 0.01
R4669:Brms1l UTSW 12 55841571 missense possibly damaging 0.83
R4987:Brms1l UTSW 12 55866015 missense probably benign 0.15
R6010:Brms1l UTSW 12 55868200 missense possibly damaging 0.55
R6129:Brms1l UTSW 12 55868185 missense probably benign 0.03
R7429:Brms1l UTSW 12 55845299 missense probably damaging 1.00
R7430:Brms1l UTSW 12 55845299 missense probably damaging 1.00
R7510:Brms1l UTSW 12 55845322 nonsense probably null
R7543:Brms1l UTSW 12 55868212 missense probably damaging 1.00
R7855:Brms1l UTSW 12 55866053 missense possibly damaging 0.90
R7938:Brms1l UTSW 12 55866053 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGCAGTCAGGGCAAGAATCCATC -3'
(R):5'- ATGTGCCTCACAGACTTGGAGAGC -3'

Sequencing Primer
(F):5'- TCTGTTAGGAAGCAGTGATGCAC -3'
(R):5'- TCTAGATGTGTAGACTCAACGCC -3'
Posted On2014-01-29