Incidental Mutation 'R1240:H2-DMa'
ID 151964
Institutional Source Beutler Lab
Gene Symbol H2-DMa
Ensembl Gene ENSMUSG00000037649
Gene Name histocompatibility 2, class II, locus DMa
Synonyms H2-M alpha, H2-Ma, H-2Ma
MMRRC Submission 039307-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock # R1240 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 34135182-34139101 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) G to T at 34138406 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042121] [ENSMUST00000042121] [ENSMUST00000042121] [ENSMUST00000042121]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000042121
SMART Domains Protein: ENSMUSP00000037088
Gene: ENSMUSG00000037649

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MHC_II_alpha 42 123 2.83e-19 SMART
IGc1 142 212 5.82e-23 SMART
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000042121
SMART Domains Protein: ENSMUSP00000037088
Gene: ENSMUSG00000037649

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MHC_II_alpha 42 123 2.83e-19 SMART
IGc1 142 212 5.82e-23 SMART
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000042121
SMART Domains Protein: ENSMUSP00000037088
Gene: ENSMUSG00000037649

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MHC_II_alpha 42 123 2.83e-19 SMART
IGc1 142 212 5.82e-23 SMART
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000042121
SMART Domains Protein: ENSMUSP00000037088
Gene: ENSMUSG00000037649

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MHC_II_alpha 42 123 2.83e-19 SMART
IGc1 142 212 5.82e-23 SMART
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173907
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DMA belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta chain (DMB), both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired antigen presenting cell function, poor IgG responses to T-dependent antigens, reduced numbers of mature CD4+ T cells, and increased susceptibility to Leishmania major infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T G 5: 124,089,921 I86L probably benign Het
Ankfn1 A G 11: 89,392,134 L229P probably damaging Het
Aoc1 T C 6: 48,905,615 S164P probably benign Het
Arhgef28 C T 13: 97,929,492 V1618I probably benign Het
Arpc3 T C 5: 122,404,179 F88S probably damaging Het
Asgr2 G T 11: 70,096,850 R58L possibly damaging Het
Bach2 T C 4: 32,563,198 F432S probably damaging Het
Brms1l C A 12: 55,844,508 R116S probably damaging Het
Casp2 T A 6: 42,268,945 C179S probably damaging Het
Ccdc73 A T 2: 104,991,561 E618D probably benign Het
Cdh6 T A 15: 13,057,455 D260V possibly damaging Het
Cenpc1 G T 5: 86,035,510 N473K probably benign Het
Chst2 T C 9: 95,405,483 E270G possibly damaging Het
Chst9 C T 18: 15,453,174 E111K probably benign Het
Cyp3a44 T G 5: 145,774,440 I474L probably benign Het
Dbr1 G T 9: 99,584,020 E550D probably benign Het
Dirc2 A G 16: 35,698,009 F445L probably benign Het
Dph6 T C 2: 114,644,718 probably null Het
Fam227b T A 2: 126,124,585 I136L possibly damaging Het
Fam46b T C 4: 133,486,504 F229L probably benign Het
Fcgbp A G 7: 28,120,525 N2559S probably damaging Het
Fh1 A T 1: 175,604,015 I435N probably damaging Het
Gab1 A C 8: 80,788,530 S386R probably damaging Het
Gkn1 T A 6: 87,349,116 N31Y probably damaging Het
Grk2 A G 19: 4,290,679 C251R probably damaging Het
Hp1bp3 T C 4: 138,229,698 S63P probably damaging Het
Ift74 A G 4: 94,692,937 probably null Het
Inf2 G A 12: 112,610,776 R1018Q unknown Het
Kat2b A G 17: 53,624,397 D141G probably benign Het
Klhl30 T C 1: 91,361,015 S499P probably benign Het
Lama2 A C 10: 27,041,124 D2268E probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Marf1 T C 16: 14,146,762 N258S possibly damaging Het
Mc1r T A 8: 123,408,260 C251S probably damaging Het
Myo15b C A 11: 115,880,501 Q257K possibly damaging Het
Nbeal2 A G 9: 110,627,108 F2431S probably damaging Het
Neb T A 2: 52,296,309 H917L possibly damaging Het
Nlrp1a A G 11: 71,113,466 probably null Het
Nr1d2 A T 14: 18,211,891 M404K probably benign Het
Olfr32 T G 2: 90,138,813 I109L possibly damaging Het
Olfr52 T G 2: 86,182,109 M1L possibly damaging Het
Otoa T C 7: 121,156,490 S1040P probably benign Het
Pctp T C 11: 90,002,814 D10G probably benign Het
Pja2 G T 17: 64,309,618 T94K probably benign Het
Plxna1 C T 6: 89,321,050 V1749M probably damaging Het
Prdm15 C T 16: 97,837,600 E87K probably damaging Het
Rgsl1 A G 1: 153,785,191 F1028L probably benign Het
Sepsecs T C 5: 52,660,679 N252S probably damaging Het
Skint5 A T 4: 113,717,107 L749Q unknown Het
Slc22a22 G A 15: 57,250,872 S353F probably benign Het
Slc7a13 A T 4: 19,819,212 K137N probably damaging Het
Snx13 G T 12: 35,091,406 V163L probably damaging Het
Synrg A T 11: 84,023,356 T1115S probably damaging Het
Tenm3 A G 8: 48,287,893 V1185A possibly damaging Het
Tg T A 15: 66,828,548 N118K probably benign Het
Top1mt T C 15: 75,670,067 K153E probably damaging Het
Trmt11 T C 10: 30,590,825 probably benign Het
Unc80 A G 1: 66,635,902 D1953G possibly damaging Het
Vmn2r25 T A 6: 123,851,905 S137C probably damaging Het
Vwf C A 6: 125,603,308 probably null Het
Other mutations in H2-DMa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03286:H2-DMa APN 17 34137109 splice site probably null
R0422:H2-DMa UTSW 17 34137947 missense probably damaging 1.00
R0620:H2-DMa UTSW 17 34137960 missense probably damaging 0.96
R1483:H2-DMa UTSW 17 34135750 missense possibly damaging 0.61
R1656:H2-DMa UTSW 17 34138142 missense possibly damaging 0.92
R1657:H2-DMa UTSW 17 34137399 critical splice donor site probably null
R1696:H2-DMa UTSW 17 34138413 missense probably benign 0.44
R2884:H2-DMa UTSW 17 34137147 missense probably damaging 1.00
R2886:H2-DMa UTSW 17 34137147 missense probably damaging 1.00
R5024:H2-DMa UTSW 17 34138487 missense possibly damaging 0.77
R5236:H2-DMa UTSW 17 34137939 missense probably damaging 1.00
R5632:H2-DMa UTSW 17 34138001 missense probably benign 0.14
R6358:H2-DMa UTSW 17 34137984 missense probably damaging 1.00
R6423:H2-DMa UTSW 17 34137196 missense probably benign 0.05
R7033:H2-DMa UTSW 17 34136997 splice site probably null
R7387:H2-DMa UTSW 17 34138127 missense probably damaging 1.00
R8060:H2-DMa UTSW 17 34137285 missense probably benign 0.05
R8504:H2-DMa UTSW 17 34138442 missense probably damaging 1.00
R8813:H2-DMa UTSW 17 34135760 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- ACACGAGATTGACCGCTACACG -3'
(R):5'- TGGAGAATCCTGGCACACACTGAC -3'

Sequencing Primer
(F):5'- ATGGAAGTCCGGTCCTTCAAG -3'
(R):5'- ACTGACACGGCACTCTTG -3'
Posted On 2014-01-29