Incidental Mutation 'R1241:Wisp2'
ID151977
Institutional Source Beutler Lab
Gene Symbol Wisp2
Ensembl Gene ENSMUSG00000027656
Gene NameWNT1 inducible signaling pathway protein 2
SynonymsrCop1, Crgr4, CCN5
MMRRC Submission 039308-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1241 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location163820861-163833146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 163829077 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 168 (M168K)
Ref Sequence ENSEMBL: ENSMUSP00000029188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029188]
Predicted Effect unknown
Transcript: ENSMUST00000029188
AA Change: M168K
SMART Domains Protein: ENSMUSP00000029188
Gene: ENSMUSG00000027656
AA Change: M168K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IB 24 93 1.67e-16 SMART
VWC 100 163 5.9e-16 SMART
TSP1 195 239 9.68e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138730
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like (CT) domain. The encoded protein lacks the CT domain which is implicated in dimerization and heparin binding. It is 72% identical to the mouse protein at the amino acid level. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Its expression in colon tumors is reduced while the other two WISP members are overexpressed in colon tumors. It is expressed at high levels in bone tissue, and may play an important role in modulating bone turnover. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viabe and overtly normal with no adult bone phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
9030619P08Rik A C 15: 75,429,997 noncoding transcript Het
Aldh1l2 T C 10: 83,496,025 I639V probably benign Het
Ambra1 T C 2: 91,770,896 probably benign Het
Ap5z1 T C 5: 142,470,114 Y299H probably damaging Het
Atp6v1b1 A T 6: 83,756,544 probably benign Het
Atr G A 9: 95,950,636 V2574I probably benign Het
Atxn1l T A 8: 109,732,980 T217S probably benign Het
Ccdc85a A G 11: 28,396,150 S89P probably benign Het
Cd209e A T 8: 3,849,124 I196N probably damaging Het
Cdhr4 A G 9: 107,995,296 S247G probably benign Het
Cntn6 A T 6: 104,832,509 I502F probably damaging Het
Crisp4 T C 1: 18,122,794 Y233C probably damaging Het
Ctsb C A 14: 63,139,104 T261N probably benign Het
Ctsk T C 3: 95,500,874 F14L probably benign Het
Dchs1 T C 7: 105,758,178 I2110V probably damaging Het
Dennd5b A G 6: 149,068,490 M155T probably benign Het
Echdc3 T C 2: 6,212,800 D54G probably benign Het
Egln3 G A 12: 54,181,693 T209I probably damaging Het
Fbn1 A C 2: 125,372,527 probably benign Het
Fkbp15 A T 4: 62,304,609 S1018T possibly damaging Het
Flnb T C 14: 7,896,503 I898T probably benign Het
Flt1 T A 5: 147,599,646 Y795F probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fryl A G 5: 73,064,925 probably benign Het
Fryl T C 5: 73,110,271 E417G probably damaging Het
Gcnt3 T C 9: 70,034,333 I318V probably benign Het
Gm11437 T A 11: 84,164,628 H54L possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Jarid2 G A 13: 44,884,892 probably benign Het
Kif5b A T 18: 6,214,044 V653E probably benign Het
Kmt2b A G 7: 30,574,940 V2113A probably damaging Het
Knl1 C T 2: 119,072,573 T1585I probably benign Het
Mlxipl T A 5: 135,132,718 M497K probably benign Het
Mre11a T A 9: 14,799,639 W210R probably damaging Het
Mrps22 A G 9: 98,594,695 V207A probably benign Het
Myo15 A G 11: 60,499,430 I2111V possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Nbea T A 3: 56,058,040 H484L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nlrp2 T A 7: 5,328,431 D322V probably damaging Het
Nrcam T C 12: 44,590,164 C1057R probably damaging Het
Ntsr1 T C 2: 180,500,601 S62P probably damaging Het
Nudt18 A G 14: 70,579,427 H157R probably benign Het
Olfr1002 T A 2: 85,647,560 T254S probably damaging Het
Olfr982 C A 9: 40,074,896 N200K probably damaging Het
Sidt2 T C 9: 45,945,704 T435A probably damaging Het
Snx27 T C 3: 94,520,233 T312A probably benign Het
Srebf2 T C 15: 82,177,519 S429P probably damaging Het
Suclg2 A G 6: 95,497,582 probably benign Het
Tchh A T 3: 93,444,972 E573V unknown Het
Tdrd1 A G 19: 56,861,760 T985A probably benign Het
Ttc7b A G 12: 100,403,439 I357T possibly damaging Het
Ttn T C 2: 76,795,664 E13271G probably damaging Het
Usp13 A G 3: 32,915,708 E661G probably damaging Het
Vasp T G 7: 19,259,033 probably benign Het
Vmn2r109 A T 17: 20,555,241 Y75N possibly damaging Het
Vmn2r15 T A 5: 109,292,904 N363Y probably damaging Het
Vmn2r60 T A 7: 42,137,052 N426K probably benign Het
Znhit2 C A 19: 6,062,258 N344K probably damaging Het
Other mutations in Wisp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Wisp2 APN 2 163829022 missense probably damaging 1.00
BB002:Wisp2 UTSW 2 163829041 missense possibly damaging 0.82
BB012:Wisp2 UTSW 2 163829041 missense possibly damaging 0.82
R0336:Wisp2 UTSW 2 163832322 missense probably damaging 0.98
R0600:Wisp2 UTSW 2 163825313 missense probably damaging 1.00
R1779:Wisp2 UTSW 2 163828986 missense probably damaging 1.00
R2921:Wisp2 UTSW 2 163832346 missense probably benign 0.11
R2923:Wisp2 UTSW 2 163832346 missense probably benign 0.11
R4049:Wisp2 UTSW 2 163828984 missense probably damaging 1.00
R4344:Wisp2 UTSW 2 163828986 missense probably damaging 1.00
R5409:Wisp2 UTSW 2 163825238 missense probably damaging 1.00
R5529:Wisp2 UTSW 2 163825359 critical splice donor site probably null
R5663:Wisp2 UTSW 2 163825253 missense probably damaging 1.00
R6401:Wisp2 UTSW 2 163829026 missense probably benign 0.45
R6685:Wisp2 UTSW 2 163828948 missense possibly damaging 0.87
R7242:Wisp2 UTSW 2 163828852 missense probably benign 0.27
R7925:Wisp2 UTSW 2 163829041 missense possibly damaging 0.82
R8066:Wisp2 UTSW 2 163828942 missense probably damaging 1.00
R8701:Wisp2 UTSW 2 163828866 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGGATGGGGAGACCTTTAAACC -3'
(R):5'- CCCTGACTTAGCCACCTGAACTTG -3'

Sequencing Primer
(F):5'- GGGAGACCTTTAAACCCAATTGC -3'
(R):5'- cccagaccctcacaagaac -3'
Posted On2014-01-29