Mutagenetix > Incidental Mutation

Incidental Mutation 'R1241:Wisp2'

151977

Institutional Source

Beutler Lab

Gene Symbol

Wisp2

Ensembl Gene

ENSMUSG00000027656

Gene Name

WNT1 inducible signaling pathway protein 2

Synonyms

rCop1, Crgr4, CCN5

MMRRC Submission

039308-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1241 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

163820861-163833146 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 163829077 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 168 (M168K)

Ref Sequence

ENSEMBL: ENSMUSP00000029188 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029188]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000029188
AA Change: M168K

SMART Domains

Protein: ENSMUSP00000029188
Gene: ENSMUSG00000027656
AA Change: M168K

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IB	24	93	1.67e-16	SMART
VWC	100	163	5.9e-16	SMART
TSP1	195	239	9.68e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138730

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 91.5%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like (CT) domain. The encoded protein lacks the CT domain which is implicated in dimerization and heparin binding. It is 72% identical to the mouse protein at the amino acid level. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Its expression in colon tumors is reduced while the other two WISP members are overexpressed in colon tumors. It is expressed at high levels in bone tissue, and may play an important role in modulating bone turnover. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viabe and overtly normal with no adult bone phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700056E22Rik	C	T	1: 184,033,505	S119N	probably benign	Het
9030619P08Rik	A	C	15: 75,429,997		noncoding transcript	Het
Aldh1l2	T	C	10: 83,496,025	I639V	probably benign	Het
Ambra1	T	C	2: 91,770,896		probably benign	Het
Ap5z1	T	C	5: 142,470,114	Y299H	probably damaging	Het
Atp6v1b1	A	T	6: 83,756,544		probably benign	Het
Atr	G	A	9: 95,950,636	V2574I	probably benign	Het
Atxn1l	T	A	8: 109,732,980	T217S	probably benign	Het
Ccdc85a	A	G	11: 28,396,150	S89P	probably benign	Het
Cd209e	A	T	8: 3,849,124	I196N	probably damaging	Het
Cdhr4	A	G	9: 107,995,296	S247G	probably benign	Het
Cntn6	A	T	6: 104,832,509	I502F	probably damaging	Het
Crisp4	T	C	1: 18,122,794	Y233C	probably damaging	Het
Ctsb	C	A	14: 63,139,104	T261N	probably benign	Het
Ctsk	T	C	3: 95,500,874	F14L	probably benign	Het
Dchs1	T	C	7: 105,758,178	I2110V	probably damaging	Het
Dennd5b	A	G	6: 149,068,490	M155T	probably benign	Het
Echdc3	T	C	2: 6,212,800	D54G	probably benign	Het
Egln3	G	A	12: 54,181,693	T209I	probably damaging	Het
Fbn1	A	C	2: 125,372,527		probably benign	Het
Fkbp15	A	T	4: 62,304,609	S1018T	possibly damaging	Het
Flnb	T	C	14: 7,896,503	I898T	probably benign	Het
Flt1	T	A	5: 147,599,646	Y795F	probably damaging	Het
Flt4	C	T	11: 49,636,339		probably benign	Het
Fryl	A	G	5: 73,064,925		probably benign	Het
Fryl	T	C	5: 73,110,271	E417G	probably damaging	Het
Gcnt3	T	C	9: 70,034,333	I318V	probably benign	Het
Gm11437	T	A	11: 84,164,628	H54L	possibly damaging	Het
Huwe1	AGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGA	X: 151,907,048		probably benign	Het
Jarid2	G	A	13: 44,884,892		probably benign	Het
Kif5b	A	T	18: 6,214,044	V653E	probably benign	Het
Kmt2b	A	G	7: 30,574,940	V2113A	probably damaging	Het
Knl1	C	T	2: 119,072,573	T1585I	probably benign	Het
Mlxipl	T	A	5: 135,132,718	M497K	probably benign	Het
Mre11a	T	A	9: 14,799,639	W210R	probably damaging	Het
Mrps22	A	G	9: 98,594,695	V207A	probably benign	Het
Myo15	A	G	11: 60,499,430	I2111V	possibly damaging	Het
Myo1a	C	T	10: 127,719,279	P838L	probably benign	Het
Nbea	T	A	3: 56,058,040	H484L	probably damaging	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Nlrp2	T	A	7: 5,328,431	D322V	probably damaging	Het
Nrcam	T	C	12: 44,590,164	C1057R	probably damaging	Het
Ntsr1	T	C	2: 180,500,601	S62P	probably damaging	Het
Nudt18	A	G	14: 70,579,427	H157R	probably benign	Het
Olfr1002	T	A	2: 85,647,560	T254S	probably damaging	Het
Olfr982	C	A	9: 40,074,896	N200K	probably damaging	Het
Sidt2	T	C	9: 45,945,704	T435A	probably damaging	Het
Snx27	T	C	3: 94,520,233	T312A	probably benign	Het
Srebf2	T	C	15: 82,177,519	S429P	probably damaging	Het
Suclg2	A	G	6: 95,497,582		probably benign	Het
Tchh	A	T	3: 93,444,972	E573V	unknown	Het
Tdrd1	A	G	19: 56,861,760	T985A	probably benign	Het
Ttc7b	A	G	12: 100,403,439	I357T	possibly damaging	Het
Ttn	T	C	2: 76,795,664	E13271G	probably damaging	Het
Usp13	A	G	3: 32,915,708	E661G	probably damaging	Het
Vasp	T	G	7: 19,259,033		probably benign	Het
Vmn2r109	A	T	17: 20,555,241	Y75N	possibly damaging	Het
Vmn2r15	T	A	5: 109,292,904	N363Y	probably damaging	Het
Vmn2r60	T	A	7: 42,137,052	N426K	probably benign	Het
Znhit2	C	A	19: 6,062,258	N344K	probably damaging	Het

Other mutations in Wisp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01447:Wisp2	APN	2	163829022	missense	probably damaging	1.00
BB002:Wisp2	UTSW	2	163829041	missense	possibly damaging	0.82
BB012:Wisp2	UTSW	2	163829041	missense	possibly damaging	0.82
R0336:Wisp2	UTSW	2	163832322	missense	probably damaging	0.98
R0600:Wisp2	UTSW	2	163825313	missense	probably damaging	1.00
R1779:Wisp2	UTSW	2	163828986	missense	probably damaging	1.00
R2921:Wisp2	UTSW	2	163832346	missense	probably benign	0.11
R2923:Wisp2	UTSW	2	163832346	missense	probably benign	0.11
R4049:Wisp2	UTSW	2	163828984	missense	probably damaging	1.00
R4344:Wisp2	UTSW	2	163828986	missense	probably damaging	1.00
R5409:Wisp2	UTSW	2	163825238	missense	probably damaging	1.00
R5529:Wisp2	UTSW	2	163825359	critical splice donor site	probably null
R5663:Wisp2	UTSW	2	163825253	missense	probably damaging	1.00
R6401:Wisp2	UTSW	2	163829026	missense	probably benign	0.45
R6685:Wisp2	UTSW	2	163828948	missense	possibly damaging	0.87
R7242:Wisp2	UTSW	2	163828852	missense	probably benign	0.27
R7925:Wisp2	UTSW	2	163829041	missense	possibly damaging	0.82
R8066:Wisp2	UTSW	2	163828942	missense	probably damaging	1.00
R8701:Wisp2	UTSW	2	163828866	missense	probably damaging	1.00
R8962:Wisp2	UTSW	2	163825240	nonsense	probably null
R9215:Wisp2	UTSW	2	163829046	missense	probably damaging	1.00
R9656:Wisp2	UTSW	2	163829065	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ACCTGGATGGGGAGACCTTTAAACC -3'
(R):5'- CCCTGACTTAGCCACCTGAACTTG -3'

Sequencing Primer
(F):5'- GGGAGACCTTTAAACCCAATTGC -3'
(R):5'- cccagaccctcacaagaac -3'

Posted On

2014-01-29