Incidental Mutation 'R1241:Usp13'
Institutional Source Beutler Lab
Gene Symbol Usp13
Ensembl Gene ENSMUSG00000056900
Gene Nameubiquitin specific peptidase 13 (isopeptidase T-3)
SynonymsISOT3, 2700071E21Rik, IsoT-3
MMRRC Submission 039308-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1241 (G1)
Quality Score169
Status Validated
Chromosomal Location32817546-32938071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32915708 bp
Amino Acid Change Glutamic Acid to Glycine at position 661 (E661G)
Ref Sequence ENSEMBL: ENSMUSP00000072155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072312] [ENSMUST00000108228] [ENSMUST00000172481]
Predicted Effect probably damaging
Transcript: ENSMUST00000072312
AA Change: E661G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000072155
Gene: ENSMUSG00000056900
AA Change: E661G

low complexity region 12 23 N/A INTRINSIC
Blast:ZnF_UBP 46 91 1e-17 BLAST
low complexity region 116 134 N/A INTRINSIC
ZnF_UBP 208 263 2.91e-20 SMART
low complexity region 625 639 N/A INTRINSIC
UBA 652 690 1.25e-6 SMART
UBA 724 761 1.19e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108228
AA Change: E660G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103863
Gene: ENSMUSG00000056900
AA Change: E660G

low complexity region 12 23 N/A INTRINSIC
Blast:ZnF_UBP 46 91 1e-17 BLAST
low complexity region 115 133 N/A INTRINSIC
ZnF_UBP 207 262 2.91e-20 SMART
low complexity region 624 638 N/A INTRINSIC
UBA 651 689 1.25e-6 SMART
UBA 723 760 1.19e-12 SMART
Predicted Effect unknown
Transcript: ENSMUST00000156769
AA Change: E17G
SMART Domains Protein: ENSMUSP00000117605
Gene: ENSMUSG00000056900
AA Change: E17G

UBA 9 47 1.25e-6 SMART
UBA 81 118 1.19e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172481
SMART Domains Protein: ENSMUSP00000133823
Gene: ENSMUSG00000056900

low complexity region 12 23 N/A INTRINSIC
Blast:ZnF_UBP 46 91 9e-18 BLAST
low complexity region 116 134 N/A INTRINSIC
ZnF_UBP 208 263 2.91e-20 SMART
Pfam:UCH 333 523 5.1e-27 PFAM
Meta Mutation Damage Score 0.1912 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
9030619P08Rik A C 15: 75,429,997 noncoding transcript Het
Aldh1l2 T C 10: 83,496,025 I639V probably benign Het
Ambra1 T C 2: 91,770,896 probably benign Het
Ap5z1 T C 5: 142,470,114 Y299H probably damaging Het
Atp6v1b1 A T 6: 83,756,544 probably benign Het
Atr G A 9: 95,950,636 V2574I probably benign Het
Atxn1l T A 8: 109,732,980 T217S probably benign Het
Ccdc85a A G 11: 28,396,150 S89P probably benign Het
Cd209e A T 8: 3,849,124 I196N probably damaging Het
Cdhr4 A G 9: 107,995,296 S247G probably benign Het
Cntn6 A T 6: 104,832,509 I502F probably damaging Het
Crisp4 T C 1: 18,122,794 Y233C probably damaging Het
Ctsb C A 14: 63,139,104 T261N probably benign Het
Ctsk T C 3: 95,500,874 F14L probably benign Het
Dchs1 T C 7: 105,758,178 I2110V probably damaging Het
Dennd5b A G 6: 149,068,490 M155T probably benign Het
Echdc3 T C 2: 6,212,800 D54G probably benign Het
Egln3 G A 12: 54,181,693 T209I probably damaging Het
Fbn1 A C 2: 125,372,527 probably benign Het
Fkbp15 A T 4: 62,304,609 S1018T possibly damaging Het
Flnb T C 14: 7,896,503 I898T probably benign Het
Flt1 T A 5: 147,599,646 Y795F probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fryl A G 5: 73,064,925 probably benign Het
Fryl T C 5: 73,110,271 E417G probably damaging Het
Gcnt3 T C 9: 70,034,333 I318V probably benign Het
Gm11437 T A 11: 84,164,628 H54L possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Jarid2 G A 13: 44,884,892 probably benign Het
Kif5b A T 18: 6,214,044 V653E probably benign Het
Kmt2b A G 7: 30,574,940 V2113A probably damaging Het
Knl1 C T 2: 119,072,573 T1585I probably benign Het
Mlxipl T A 5: 135,132,718 M497K probably benign Het
Mre11a T A 9: 14,799,639 W210R probably damaging Het
Mrps22 A G 9: 98,594,695 V207A probably benign Het
Myo15 A G 11: 60,499,430 I2111V possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Nbea T A 3: 56,058,040 H484L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nlrp2 T A 7: 5,328,431 D322V probably damaging Het
Nrcam T C 12: 44,590,164 C1057R probably damaging Het
Ntsr1 T C 2: 180,500,601 S62P probably damaging Het
Nudt18 A G 14: 70,579,427 H157R probably benign Het
Olfr1002 T A 2: 85,647,560 T254S probably damaging Het
Olfr982 C A 9: 40,074,896 N200K probably damaging Het
Sidt2 T C 9: 45,945,704 T435A probably damaging Het
Snx27 T C 3: 94,520,233 T312A probably benign Het
Srebf2 T C 15: 82,177,519 S429P probably damaging Het
Suclg2 A G 6: 95,497,582 probably benign Het
Tchh A T 3: 93,444,972 E573V unknown Het
Tdrd1 A G 19: 56,861,760 T985A probably benign Het
Ttc7b A G 12: 100,403,439 I357T possibly damaging Het
Ttn T C 2: 76,795,664 E13271G probably damaging Het
Vasp T G 7: 19,259,033 probably benign Het
Vmn2r109 A T 17: 20,555,241 Y75N possibly damaging Het
Vmn2r15 T A 5: 109,292,904 N363Y probably damaging Het
Vmn2r60 T A 7: 42,137,052 N426K probably benign Het
Wisp2 T A 2: 163,829,077 M168K unknown Het
Znhit2 C A 19: 6,062,258 N344K probably damaging Het
Other mutations in Usp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Usp13 APN 3 32881411 missense probably damaging 0.98
IGL00949:Usp13 APN 3 32886577 missense possibly damaging 0.57
IGL01637:Usp13 APN 3 32919064 missense probably benign 0.02
IGL01983:Usp13 APN 3 32917459 missense probably damaging 1.00
IGL02002:Usp13 APN 3 32847825 missense probably damaging 0.97
IGL02065:Usp13 APN 3 32933165 missense probably damaging 1.00
IGL02390:Usp13 APN 3 32931716 nonsense probably null
IGL02399:Usp13 APN 3 32919060 missense probably damaging 1.00
IGL02535:Usp13 APN 3 32837926 missense probably benign 0.43
IGL02863:Usp13 APN 3 32918947 missense possibly damaging 0.95
IGL03017:Usp13 APN 3 32915712 missense possibly damaging 0.90
IGL03242:Usp13 APN 3 32902069 missense probably benign 0.17
PIT4504001:Usp13 UTSW 3 32905430 missense probably damaging 1.00
R0113:Usp13 UTSW 3 32817876 splice site probably benign
R0233:Usp13 UTSW 3 32915664 splice site probably null
R0233:Usp13 UTSW 3 32915664 splice site probably null
R1765:Usp13 UTSW 3 32915770 missense probably benign 0.01
R2105:Usp13 UTSW 3 32901986 missense probably damaging 0.97
R2229:Usp13 UTSW 3 32917551 missense probably benign 0.02
R2381:Usp13 UTSW 3 32881509 critical splice donor site probably null
R2389:Usp13 UTSW 3 32905464 missense probably benign 0.16
R3801:Usp13 UTSW 3 32881508 missense possibly damaging 0.75
R4062:Usp13 UTSW 3 32881423 missense probably damaging 1.00
R4653:Usp13 UTSW 3 32837924 missense probably damaging 0.99
R5123:Usp13 UTSW 3 32915798 missense probably benign 0.03
R5454:Usp13 UTSW 3 32905436 missense probably damaging 1.00
R5527:Usp13 UTSW 3 32865838 missense probably damaging 1.00
R5582:Usp13 UTSW 3 32911589 missense probably damaging 1.00
R5589:Usp13 UTSW 3 32837858 missense probably damaging 1.00
R5829:Usp13 UTSW 3 32886523 missense possibly damaging 0.68
R6114:Usp13 UTSW 3 32854669 missense probably damaging 1.00
R6625:Usp13 UTSW 3 32894876 missense probably damaging 0.98
R6680:Usp13 UTSW 3 32881469 missense probably damaging 0.98
R7175:Usp13 UTSW 3 32917608 nonsense probably null
R7232:Usp13 UTSW 3 32865871 missense probably benign 0.05
R7242:Usp13 UTSW 3 32865743 splice site probably null
R7263:Usp13 UTSW 3 32894851 missense probably damaging 1.00
R7533:Usp13 UTSW 3 32918942 missense probably damaging 0.99
R7716:Usp13 UTSW 3 32837856 nonsense probably null
R7734:Usp13 UTSW 3 32837905 missense probably benign 0.13
R7943:Usp13 UTSW 3 32876940 missense probably damaging 1.00
R8075:Usp13 UTSW 3 32931703 missense probably damaging 1.00
R8141:Usp13 UTSW 3 32894876 missense possibly damaging 0.52
R8259:Usp13 UTSW 3 32917599 nonsense probably null
R8722:Usp13 UTSW 3 32901965 missense probably benign 0.00
X0064:Usp13 UTSW 3 32886589 critical splice donor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- acaatccactccctactctatattc -3'
Posted On2014-01-29