Incidental Mutation 'R1241:Ctsk'
ID151983
Institutional Source Beutler Lab
Gene Symbol Ctsk
Ensembl Gene ENSMUSG00000028111
Gene Namecathepsin K
SynonymsCat K, catK
MMRRC Submission 039308-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1241 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95499256-95509362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95500874 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 14 (F14L)
Ref Sequence ENSEMBL: ENSMUSP00000015664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015664] [ENSMUST00000090804] [ENSMUST00000107161]
Predicted Effect probably benign
Transcript: ENSMUST00000015664
AA Change: F14L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000015664
Gene: ENSMUSG00000028111
AA Change: F14L

DomainStartEndE-ValueType
Inhibitor_I29 26 86 1.48e-22 SMART
Pept_C1 115 328 4.25e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090804
SMART Domains Protein: ENSMUSP00000088313
Gene: ENSMUSG00000015522

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 80 133 1e-14 SMART
PAS 148 215 1.51e-10 SMART
low complexity region 236 247 N/A INTRINSIC
PAS 337 402 1.55e-7 SMART
PAC 409 452 1.95e-4 SMART
low complexity region 710 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107161
SMART Domains Protein: ENSMUSP00000102779
Gene: ENSMUSG00000015522

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 80 133 1e-14 SMART
PAS 148 215 1.51e-10 SMART
low complexity region 236 247 N/A INTRINSIC
PAS 337 402 1.55e-7 SMART
PAC 409 452 1.95e-4 SMART
low complexity region 694 707 N/A INTRINSIC
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a member of the cathepsin family of cysteine proteases that is highly expressed in osteoclasts and is involved in the degradation of collagen and other matrix proteins in bone. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional enzyme. Mice lacking the encoded protein exhibit phenotypic features of pycnodysostosis such as increased bone density and bone deformity, which become progressively more pronounced with age. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene survive well and are fertile. They have osteopetrosis, reduced levels of thyroxine and increased pulmonary fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
9030619P08Rik A C 15: 75,429,997 noncoding transcript Het
Aldh1l2 T C 10: 83,496,025 I639V probably benign Het
Ambra1 T C 2: 91,770,896 probably benign Het
Ap5z1 T C 5: 142,470,114 Y299H probably damaging Het
Atp6v1b1 A T 6: 83,756,544 probably benign Het
Atr G A 9: 95,950,636 V2574I probably benign Het
Atxn1l T A 8: 109,732,980 T217S probably benign Het
Ccdc85a A G 11: 28,396,150 S89P probably benign Het
Cd209e A T 8: 3,849,124 I196N probably damaging Het
Cdhr4 A G 9: 107,995,296 S247G probably benign Het
Cntn6 A T 6: 104,832,509 I502F probably damaging Het
Crisp4 T C 1: 18,122,794 Y233C probably damaging Het
Ctsb C A 14: 63,139,104 T261N probably benign Het
Dchs1 T C 7: 105,758,178 I2110V probably damaging Het
Dennd5b A G 6: 149,068,490 M155T probably benign Het
Echdc3 T C 2: 6,212,800 D54G probably benign Het
Egln3 G A 12: 54,181,693 T209I probably damaging Het
Fbn1 A C 2: 125,372,527 probably benign Het
Fkbp15 A T 4: 62,304,609 S1018T possibly damaging Het
Flnb T C 14: 7,896,503 I898T probably benign Het
Flt1 T A 5: 147,599,646 Y795F probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fryl A G 5: 73,064,925 probably benign Het
Fryl T C 5: 73,110,271 E417G probably damaging Het
Gcnt3 T C 9: 70,034,333 I318V probably benign Het
Gm11437 T A 11: 84,164,628 H54L possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Jarid2 G A 13: 44,884,892 probably benign Het
Kif5b A T 18: 6,214,044 V653E probably benign Het
Kmt2b A G 7: 30,574,940 V2113A probably damaging Het
Knl1 C T 2: 119,072,573 T1585I probably benign Het
Mlxipl T A 5: 135,132,718 M497K probably benign Het
Mre11a T A 9: 14,799,639 W210R probably damaging Het
Mrps22 A G 9: 98,594,695 V207A probably benign Het
Myo15 A G 11: 60,499,430 I2111V possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Nbea T A 3: 56,058,040 H484L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nlrp2 T A 7: 5,328,431 D322V probably damaging Het
Nrcam T C 12: 44,590,164 C1057R probably damaging Het
Ntsr1 T C 2: 180,500,601 S62P probably damaging Het
Nudt18 A G 14: 70,579,427 H157R probably benign Het
Olfr1002 T A 2: 85,647,560 T254S probably damaging Het
Olfr982 C A 9: 40,074,896 N200K probably damaging Het
Sidt2 T C 9: 45,945,704 T435A probably damaging Het
Snx27 T C 3: 94,520,233 T312A probably benign Het
Srebf2 T C 15: 82,177,519 S429P probably damaging Het
Suclg2 A G 6: 95,497,582 probably benign Het
Tchh A T 3: 93,444,972 E573V unknown Het
Tdrd1 A G 19: 56,861,760 T985A probably benign Het
Ttc7b A G 12: 100,403,439 I357T possibly damaging Het
Ttn T C 2: 76,795,664 E13271G probably damaging Het
Usp13 A G 3: 32,915,708 E661G probably damaging Het
Vasp T G 7: 19,259,033 probably benign Het
Vmn2r109 A T 17: 20,555,241 Y75N possibly damaging Het
Vmn2r15 T A 5: 109,292,904 N363Y probably damaging Het
Vmn2r60 T A 7: 42,137,052 N426K probably benign Het
Wisp2 T A 2: 163,829,077 M168K unknown Het
Znhit2 C A 19: 6,062,258 N344K probably damaging Het
Other mutations in Ctsk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03149:Ctsk APN 3 95501419 missense possibly damaging 0.73
R0255:Ctsk UTSW 3 95508877 missense probably benign 0.00
R0362:Ctsk UTSW 3 95500944 missense probably damaging 1.00
R2014:Ctsk UTSW 3 95506692 missense probably damaging 1.00
R2110:Ctsk UTSW 3 95506677 missense probably benign 0.35
R5597:Ctsk UTSW 3 95501696 missense probably damaging 0.99
R5990:Ctsk UTSW 3 95501456 missense probably damaging 1.00
R6363:Ctsk UTSW 3 95501551 missense probably damaging 1.00
R6754:Ctsk UTSW 3 95502685 missense probably damaging 1.00
R7142:Ctsk UTSW 3 95506948 missense possibly damaging 0.83
R7610:Ctsk UTSW 3 95500844 missense probably benign
R7670:Ctsk UTSW 3 95501614 missense probably benign 0.00
X0005:Ctsk UTSW 3 95500938 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTGCCTGTCTCACAGTCAAATG -3'
(R):5'- AAGTGTTCCTTAAAAGAGCCTTCCCC -3'

Sequencing Primer
(F):5'- acaggggagagggggtag -3'
(R):5'- gaccagccatccgttcc -3'
Posted On2014-01-29