Incidental Mutation 'R1241:Vmn2r15'
ID151987
Institutional Source Beutler Lab
Gene Symbol Vmn2r15
Ensembl Gene ENSMUSG00000091375
Gene Namevomeronasal 2, receptor 15
SynonymsEG211223
MMRRC Submission 039308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R1241 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location109286269-109297556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109292904 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 363 (N363Y)
Ref Sequence ENSEMBL: ENSMUSP00000128333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167133]
Predicted Effect probably damaging
Transcript: ENSMUST00000167133
AA Change: N363Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128333
Gene: ENSMUSG00000091375
AA Change: N363Y

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 75 472 1e-29 PFAM
Pfam:NCD3G 514 568 5.8e-18 PFAM
Pfam:7tm_3 601 836 9.1e-55 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
9030619P08Rik A C 15: 75,429,997 noncoding transcript Het
Aldh1l2 T C 10: 83,496,025 I639V probably benign Het
Ambra1 T C 2: 91,770,896 probably benign Het
Ap5z1 T C 5: 142,470,114 Y299H probably damaging Het
Atp6v1b1 A T 6: 83,756,544 probably benign Het
Atr G A 9: 95,950,636 V2574I probably benign Het
Atxn1l T A 8: 109,732,980 T217S probably benign Het
Ccdc85a A G 11: 28,396,150 S89P probably benign Het
Cd209e A T 8: 3,849,124 I196N probably damaging Het
Cdhr4 A G 9: 107,995,296 S247G probably benign Het
Cntn6 A T 6: 104,832,509 I502F probably damaging Het
Crisp4 T C 1: 18,122,794 Y233C probably damaging Het
Ctsb C A 14: 63,139,104 T261N probably benign Het
Ctsk T C 3: 95,500,874 F14L probably benign Het
Dchs1 T C 7: 105,758,178 I2110V probably damaging Het
Dennd5b A G 6: 149,068,490 M155T probably benign Het
Echdc3 T C 2: 6,212,800 D54G probably benign Het
Egln3 G A 12: 54,181,693 T209I probably damaging Het
Fbn1 A C 2: 125,372,527 probably benign Het
Fkbp15 A T 4: 62,304,609 S1018T possibly damaging Het
Flnb T C 14: 7,896,503 I898T probably benign Het
Flt1 T A 5: 147,599,646 Y795F probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fryl A G 5: 73,064,925 probably benign Het
Fryl T C 5: 73,110,271 E417G probably damaging Het
Gcnt3 T C 9: 70,034,333 I318V probably benign Het
Gm11437 T A 11: 84,164,628 H54L possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Jarid2 G A 13: 44,884,892 probably benign Het
Kif5b A T 18: 6,214,044 V653E probably benign Het
Kmt2b A G 7: 30,574,940 V2113A probably damaging Het
Knl1 C T 2: 119,072,573 T1585I probably benign Het
Mlxipl T A 5: 135,132,718 M497K probably benign Het
Mre11a T A 9: 14,799,639 W210R probably damaging Het
Mrps22 A G 9: 98,594,695 V207A probably benign Het
Myo15 A G 11: 60,499,430 I2111V possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Nbea T A 3: 56,058,040 H484L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nlrp2 T A 7: 5,328,431 D322V probably damaging Het
Nrcam T C 12: 44,590,164 C1057R probably damaging Het
Ntsr1 T C 2: 180,500,601 S62P probably damaging Het
Nudt18 A G 14: 70,579,427 H157R probably benign Het
Olfr1002 T A 2: 85,647,560 T254S probably damaging Het
Olfr982 C A 9: 40,074,896 N200K probably damaging Het
Sidt2 T C 9: 45,945,704 T435A probably damaging Het
Snx27 T C 3: 94,520,233 T312A probably benign Het
Srebf2 T C 15: 82,177,519 S429P probably damaging Het
Suclg2 A G 6: 95,497,582 probably benign Het
Tchh A T 3: 93,444,972 E573V unknown Het
Tdrd1 A G 19: 56,861,760 T985A probably benign Het
Ttc7b A G 12: 100,403,439 I357T possibly damaging Het
Ttn T C 2: 76,795,664 E13271G probably damaging Het
Usp13 A G 3: 32,915,708 E661G probably damaging Het
Vasp T G 7: 19,259,033 probably benign Het
Vmn2r109 A T 17: 20,555,241 Y75N possibly damaging Het
Vmn2r60 T A 7: 42,137,052 N426K probably benign Het
Wisp2 T A 2: 163,829,077 M168K unknown Het
Znhit2 C A 19: 6,062,258 N344K probably damaging Het
Other mutations in Vmn2r15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Vmn2r15 APN 5 109286736 missense possibly damaging 0.70
IGL01367:Vmn2r15 APN 5 109293209 missense probably damaging 0.99
IGL01844:Vmn2r15 APN 5 109286269 makesense probably null
IGL02190:Vmn2r15 APN 5 109293374 missense probably damaging 1.00
IGL02754:Vmn2r15 APN 5 109293268 nonsense probably null
IGL02797:Vmn2r15 APN 5 109297384 missense probably benign 0.18
IGL03301:Vmn2r15 APN 5 109297355 critical splice donor site probably null
IGL03407:Vmn2r15 APN 5 109286319 nonsense probably null
PIT4445001:Vmn2r15 UTSW 5 109287142 missense probably damaging 0.99
PIT4520001:Vmn2r15 UTSW 5 109287005 missense probably damaging 1.00
R0038:Vmn2r15 UTSW 5 109293144 missense possibly damaging 0.46
R0111:Vmn2r15 UTSW 5 109287156 missense possibly damaging 0.56
R0379:Vmn2r15 UTSW 5 109286478 missense probably damaging 1.00
R0427:Vmn2r15 UTSW 5 109287087 missense probably damaging 1.00
R0639:Vmn2r15 UTSW 5 109293015 missense probably benign 0.22
R0964:Vmn2r15 UTSW 5 109297535 missense probably benign 0.34
R1147:Vmn2r15 UTSW 5 109293206 missense probably damaging 1.00
R1147:Vmn2r15 UTSW 5 109293206 missense probably damaging 1.00
R1232:Vmn2r15 UTSW 5 109293302 missense probably benign 0.39
R1244:Vmn2r15 UTSW 5 109293226 nonsense probably null
R1394:Vmn2r15 UTSW 5 109294148 missense probably benign 0.44
R1395:Vmn2r15 UTSW 5 109294148 missense probably benign 0.44
R1423:Vmn2r15 UTSW 5 109293227 missense probably damaging 1.00
R1439:Vmn2r15 UTSW 5 109294087 missense probably damaging 1.00
R1513:Vmn2r15 UTSW 5 109293329 missense probably damaging 1.00
R1777:Vmn2r15 UTSW 5 109294270 missense possibly damaging 0.79
R1844:Vmn2r15 UTSW 5 109286994 nonsense probably null
R2072:Vmn2r15 UTSW 5 109286753 missense possibly damaging 0.65
R2074:Vmn2r15 UTSW 5 109286753 missense possibly damaging 0.65
R2122:Vmn2r15 UTSW 5 109286456 missense probably damaging 1.00
R2208:Vmn2r15 UTSW 5 109297443 missense possibly damaging 0.64
R2268:Vmn2r15 UTSW 5 109293207 missense probably benign 0.31
R2831:Vmn2r15 UTSW 5 109286592 missense probably damaging 1.00
R3848:Vmn2r15 UTSW 5 109297446 missense probably benign 0.00
R4058:Vmn2r15 UTSW 5 109293446 missense probably damaging 0.99
R4615:Vmn2r15 UTSW 5 109293482 missense possibly damaging 0.91
R4663:Vmn2r15 UTSW 5 109294074 missense probably benign
R4681:Vmn2r15 UTSW 5 109286622 missense probably damaging 0.97
R4751:Vmn2r15 UTSW 5 109286754 missense probably benign 0.01
R5095:Vmn2r15 UTSW 5 109288451 critical splice acceptor site probably null
R5300:Vmn2r15 UTSW 5 109294108 missense probably damaging 0.99
R5309:Vmn2r15 UTSW 5 109293090 missense probably damaging 0.99
R5335:Vmn2r15 UTSW 5 109286807 missense probably damaging 0.99
R5421:Vmn2r15 UTSW 5 109286535 missense probably damaging 1.00
R5805:Vmn2r15 UTSW 5 109286940 missense possibly damaging 0.88
R6280:Vmn2r15 UTSW 5 109293425 missense possibly damaging 0.65
R6324:Vmn2r15 UTSW 5 109286271 makesense probably null
R6383:Vmn2r15 UTSW 5 109293226 nonsense probably null
R6772:Vmn2r15 UTSW 5 109286372 missense probably damaging 0.99
R6991:Vmn2r15 UTSW 5 109293314 missense probably damaging 1.00
R7194:Vmn2r15 UTSW 5 109292783 missense probably damaging 1.00
R7365:Vmn2r15 UTSW 5 109293239 missense probably benign 0.19
R7365:Vmn2r15 UTSW 5 109297522 missense probably benign 0.15
R7423:Vmn2r15 UTSW 5 109297528 missense probably benign 0.00
R7552:Vmn2r15 UTSW 5 109292908 nonsense probably null
R7619:Vmn2r15 UTSW 5 109288324 critical splice donor site probably null
R7892:Vmn2r15 UTSW 5 109286351 missense probably damaging 1.00
R7975:Vmn2r15 UTSW 5 109286351 missense probably damaging 1.00
R8058:Vmn2r15 UTSW 5 109293090 missense probably damaging 0.99
X0065:Vmn2r15 UTSW 5 109293308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGTGGGCCACAGCATATACAG -3'
(R):5'- CCTGAGTGACCATGACCAGTTTCC -3'

Sequencing Primer
(F):5'- CAGCATTATACAAATTGTAGCCTTCC -3'
(R):5'- CCTACAAGTCAGCTTTAGAAGGTG -3'
Posted On2014-01-29