Incidental Mutation 'R1241:Flt1'
ID151990
Institutional Source Beutler Lab
Gene Symbol Flt1
Ensembl Gene ENSMUSG00000029648
Gene NameFMS-like tyrosine kinase 1
SynonymsFlt-1, VEGFR1, vascular endothelial growth factor receptor-1, sFlt1, VEGFR-1
MMRRC Submission 039308-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1241 (G1)
Quality Score193
Status Validated
Chromosome5
Chromosomal Location147561604-147726011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 147599646 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 795 (Y795F)
Ref Sequence ENSEMBL: ENSMUSP00000031653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031653]
Predicted Effect probably damaging
Transcript: ENSMUST00000031653
AA Change: Y795F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: Y795F

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
IGc2 674 739 6.29e-19 SMART
low complexity region 769 786 N/A INTRINSIC
TyrKc 828 1154 9.54e-144 SMART
Meta Mutation Damage Score 0.2333 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
9030619P08Rik A C 15: 75,429,997 noncoding transcript Het
Aldh1l2 T C 10: 83,496,025 I639V probably benign Het
Ambra1 T C 2: 91,770,896 probably benign Het
Ap5z1 T C 5: 142,470,114 Y299H probably damaging Het
Atp6v1b1 A T 6: 83,756,544 probably benign Het
Atr G A 9: 95,950,636 V2574I probably benign Het
Atxn1l T A 8: 109,732,980 T217S probably benign Het
Ccdc85a A G 11: 28,396,150 S89P probably benign Het
Cd209e A T 8: 3,849,124 I196N probably damaging Het
Cdhr4 A G 9: 107,995,296 S247G probably benign Het
Cntn6 A T 6: 104,832,509 I502F probably damaging Het
Crisp4 T C 1: 18,122,794 Y233C probably damaging Het
Ctsb C A 14: 63,139,104 T261N probably benign Het
Ctsk T C 3: 95,500,874 F14L probably benign Het
Dchs1 T C 7: 105,758,178 I2110V probably damaging Het
Dennd5b A G 6: 149,068,490 M155T probably benign Het
Echdc3 T C 2: 6,212,800 D54G probably benign Het
Egln3 G A 12: 54,181,693 T209I probably damaging Het
Fbn1 A C 2: 125,372,527 probably benign Het
Fkbp15 A T 4: 62,304,609 S1018T possibly damaging Het
Flnb T C 14: 7,896,503 I898T probably benign Het
Flt4 C T 11: 49,636,339 probably benign Het
Fryl T C 5: 73,110,271 E417G probably damaging Het
Fryl A G 5: 73,064,925 probably benign Het
Gcnt3 T C 9: 70,034,333 I318V probably benign Het
Gm11437 T A 11: 84,164,628 H54L possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Jarid2 G A 13: 44,884,892 probably benign Het
Kif5b A T 18: 6,214,044 V653E probably benign Het
Kmt2b A G 7: 30,574,940 V2113A probably damaging Het
Knl1 C T 2: 119,072,573 T1585I probably benign Het
Mlxipl T A 5: 135,132,718 M497K probably benign Het
Mre11a T A 9: 14,799,639 W210R probably damaging Het
Mrps22 A G 9: 98,594,695 V207A probably benign Het
Myo15 A G 11: 60,499,430 I2111V possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Nbea T A 3: 56,058,040 H484L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nlrp2 T A 7: 5,328,431 D322V probably damaging Het
Nrcam T C 12: 44,590,164 C1057R probably damaging Het
Ntsr1 T C 2: 180,500,601 S62P probably damaging Het
Nudt18 A G 14: 70,579,427 H157R probably benign Het
Olfr1002 T A 2: 85,647,560 T254S probably damaging Het
Olfr982 C A 9: 40,074,896 N200K probably damaging Het
Sidt2 T C 9: 45,945,704 T435A probably damaging Het
Snx27 T C 3: 94,520,233 T312A probably benign Het
Srebf2 T C 15: 82,177,519 S429P probably damaging Het
Suclg2 A G 6: 95,497,582 probably benign Het
Tchh A T 3: 93,444,972 E573V unknown Het
Tdrd1 A G 19: 56,861,760 T985A probably benign Het
Ttc7b A G 12: 100,403,439 I357T possibly damaging Het
Ttn T C 2: 76,795,664 E13271G probably damaging Het
Usp13 A G 3: 32,915,708 E661G probably damaging Het
Vasp T G 7: 19,259,033 probably benign Het
Vmn2r109 A T 17: 20,555,241 Y75N possibly damaging Het
Vmn2r15 T A 5: 109,292,904 N363Y probably damaging Het
Vmn2r60 T A 7: 42,137,052 N426K probably benign Het
Wisp2 T A 2: 163,829,077 M168K unknown Het
Znhit2 C A 19: 6,062,258 N344K probably damaging Het
Other mutations in Flt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Flt1 APN 5 147580300 critical splice donor site probably null
IGL00469:Flt1 APN 5 147603605 missense probably damaging 0.99
IGL00897:Flt1 APN 5 147589854 missense probably benign 0.25
IGL01111:Flt1 APN 5 147578336 missense probably damaging 1.00
IGL01154:Flt1 APN 5 147576156 missense possibly damaging 0.63
IGL01744:Flt1 APN 5 147571461 missense probably benign 0.01
IGL01973:Flt1 APN 5 147683889 missense probably benign 0.01
IGL02079:Flt1 APN 5 147568831 splice site probably benign
IGL02143:Flt1 APN 5 147578436 missense probably benign 0.00
IGL02156:Flt1 APN 5 147681741 missense probably damaging 0.99
IGL02345:Flt1 APN 5 147582626 missense probably benign 0.20
IGL02548:Flt1 APN 5 147639248 missense probably benign 0.00
IGL02631:Flt1 APN 5 147673574 nonsense probably null
IGL02686:Flt1 APN 5 147588602 missense probably damaging 1.00
IGL02938:Flt1 APN 5 147678299 missense possibly damaging 0.47
IGL03057:Flt1 APN 5 147681924 nonsense probably null
IGL03196:Flt1 APN 5 147615127 critical splice donor site probably null
IGL03205:Flt1 APN 5 147699821 missense probably benign 0.00
IGL03255:Flt1 APN 5 147588521 splice site probably benign
flywheels UTSW 5 147599646 missense probably damaging 1.00
BB008:Flt1 UTSW 5 147588572 missense probably damaging 1.00
BB018:Flt1 UTSW 5 147588572 missense probably damaging 1.00
IGL02837:Flt1 UTSW 5 147655170 missense probably benign 0.32
PIT4402001:Flt1 UTSW 5 147678239 missense probably damaging 1.00
R0013:Flt1 UTSW 5 147571014 splice site probably benign
R0380:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R0448:Flt1 UTSW 5 147566394 splice site probably benign
R0789:Flt1 UTSW 5 147639483 missense probably damaging 1.00
R1005:Flt1 UTSW 5 147681885 missense probably damaging 0.99
R1302:Flt1 UTSW 5 147564240 missense possibly damaging 0.93
R1411:Flt1 UTSW 5 147580316 missense probably damaging 1.00
R1615:Flt1 UTSW 5 147639288 missense probably damaging 1.00
R1634:Flt1 UTSW 5 147676430 missense probably damaging 1.00
R1749:Flt1 UTSW 5 147655119 missense probably benign 0.00
R1768:Flt1 UTSW 5 147672709 missense probably damaging 1.00
R1972:Flt1 UTSW 5 147655093 splice site probably benign
R2074:Flt1 UTSW 5 147599606 missense possibly damaging 0.82
R2081:Flt1 UTSW 5 147639422 missense probably damaging 1.00
R2864:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R2865:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R3740:Flt1 UTSW 5 147599593 missense probably damaging 1.00
R3820:Flt1 UTSW 5 147700017 splice site probably benign
R4089:Flt1 UTSW 5 147564241 missense probably benign 0.03
R4299:Flt1 UTSW 5 147683907 missense probably benign 0.00
R4570:Flt1 UTSW 5 147594613 missense probably damaging 1.00
R4812:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4853:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4865:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4900:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4906:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4907:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4909:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5072:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5073:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5074:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5218:Flt1 UTSW 5 147681928 missense probably damaging 1.00
R5547:Flt1 UTSW 5 147655138 missense probably damaging 1.00
R5731:Flt1 UTSW 5 147678152 missense probably benign 0.16
R5732:Flt1 UTSW 5 147634483 nonsense probably null
R5804:Flt1 UTSW 5 147580437 splice site probably null
R6107:Flt1 UTSW 5 147603593 missense probably benign 0.15
R6440:Flt1 UTSW 5 147564305 missense possibly damaging 0.79
R6453:Flt1 UTSW 5 147683941 missense possibly damaging 0.80
R6539:Flt1 UTSW 5 147578376 missense probably benign 0.27
R7068:Flt1 UTSW 5 147673634 missense probably damaging 1.00
R7112:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7195:Flt1 UTSW 5 147603576 missense probably damaging 1.00
R7255:Flt1 UTSW 5 147580406 missense probably damaging 1.00
R7347:Flt1 UTSW 5 147580381 missense probably damaging 1.00
R7469:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7473:Flt1 UTSW 5 147594595 missense probably damaging 1.00
R7663:Flt1 UTSW 5 147655120 missense probably benign
R7688:Flt1 UTSW 5 147676325 missense probably benign
R7729:Flt1 UTSW 5 147700367 missense probably benign 0.00
R7931:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R8051:Flt1 UTSW 5 147582691 missense probably benign 0.02
R8275:Flt1 UTSW 5 147678147 missense probably damaging 0.99
X0064:Flt1 UTSW 5 147673613 missense probably damaging 1.00
Z1088:Flt1 UTSW 5 147681649 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGTCTCGGCAACAGACTGCATTTC -3'
(R):5'- TGTGTATTTAGGGGACCCTCTGTACC -3'

Sequencing Primer
(F):5'- GGAAGACTCCCAAGTCTTGTC -3'
(R):5'- CTCTGTACCTGGTCAATTGATGC -3'
Posted On2014-01-29