Incidental Mutation 'R1241:Atp6v1b1'
ID151991
Institutional Source Beutler Lab
Gene Symbol Atp6v1b1
Ensembl Gene ENSMUSG00000006269
Gene NameATPase, H+ transporting, lysosomal V1 subunit B1
SynonymsAtp6b1, Vpp-3, D630039P21Rik, lysosomal 56/58kDa, Vpp3, D630030L16Rik
MMRRC Submission 039308-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1241 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83742990-83758855 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 83756544 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006431] [ENSMUST00000205763]
Predicted Effect probably benign
Transcript: ENSMUST00000006431
SMART Domains Protein: ENSMUSP00000006431
Gene: ENSMUSG00000006269

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 44 110 1.9e-14 PFAM
Pfam:ATP-synt_ab 167 393 9.4e-68 PFAM
Pfam:ATP-synt_ab_C 410 508 6.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206652
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of two V1 domain B subunit isoforms and is found in the kidney. Mutations in this gene cause distal renal tubular acidosis associated with sensorineural deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation show impaired urinary acidification with a more severe metabolic acidosis and inappropriately alkaline urine after oral acid challenge. However, contrary to expectation, neither hearing nor inner ear morphology areimpaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
9030619P08Rik A C 15: 75,429,997 noncoding transcript Het
Aldh1l2 T C 10: 83,496,025 I639V probably benign Het
Ambra1 T C 2: 91,770,896 probably benign Het
Ap5z1 T C 5: 142,470,114 Y299H probably damaging Het
Atr G A 9: 95,950,636 V2574I probably benign Het
Atxn1l T A 8: 109,732,980 T217S probably benign Het
Ccdc85a A G 11: 28,396,150 S89P probably benign Het
Cd209e A T 8: 3,849,124 I196N probably damaging Het
Cdhr4 A G 9: 107,995,296 S247G probably benign Het
Cntn6 A T 6: 104,832,509 I502F probably damaging Het
Crisp4 T C 1: 18,122,794 Y233C probably damaging Het
Ctsb C A 14: 63,139,104 T261N probably benign Het
Ctsk T C 3: 95,500,874 F14L probably benign Het
Dchs1 T C 7: 105,758,178 I2110V probably damaging Het
Dennd5b A G 6: 149,068,490 M155T probably benign Het
Echdc3 T C 2: 6,212,800 D54G probably benign Het
Egln3 G A 12: 54,181,693 T209I probably damaging Het
Fbn1 A C 2: 125,372,527 probably benign Het
Fkbp15 A T 4: 62,304,609 S1018T possibly damaging Het
Flnb T C 14: 7,896,503 I898T probably benign Het
Flt1 T A 5: 147,599,646 Y795F probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fryl A G 5: 73,064,925 probably benign Het
Fryl T C 5: 73,110,271 E417G probably damaging Het
Gcnt3 T C 9: 70,034,333 I318V probably benign Het
Gm11437 T A 11: 84,164,628 H54L possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Jarid2 G A 13: 44,884,892 probably benign Het
Kif5b A T 18: 6,214,044 V653E probably benign Het
Kmt2b A G 7: 30,574,940 V2113A probably damaging Het
Knl1 C T 2: 119,072,573 T1585I probably benign Het
Mlxipl T A 5: 135,132,718 M497K probably benign Het
Mre11a T A 9: 14,799,639 W210R probably damaging Het
Mrps22 A G 9: 98,594,695 V207A probably benign Het
Myo15 A G 11: 60,499,430 I2111V possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Nbea T A 3: 56,058,040 H484L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nlrp2 T A 7: 5,328,431 D322V probably damaging Het
Nrcam T C 12: 44,590,164 C1057R probably damaging Het
Ntsr1 T C 2: 180,500,601 S62P probably damaging Het
Nudt18 A G 14: 70,579,427 H157R probably benign Het
Olfr1002 T A 2: 85,647,560 T254S probably damaging Het
Olfr982 C A 9: 40,074,896 N200K probably damaging Het
Sidt2 T C 9: 45,945,704 T435A probably damaging Het
Snx27 T C 3: 94,520,233 T312A probably benign Het
Srebf2 T C 15: 82,177,519 S429P probably damaging Het
Suclg2 A G 6: 95,497,582 probably benign Het
Tchh A T 3: 93,444,972 E573V unknown Het
Tdrd1 A G 19: 56,861,760 T985A probably benign Het
Ttc7b A G 12: 100,403,439 I357T possibly damaging Het
Ttn T C 2: 76,795,664 E13271G probably damaging Het
Usp13 A G 3: 32,915,708 E661G probably damaging Het
Vasp T G 7: 19,259,033 probably benign Het
Vmn2r109 A T 17: 20,555,241 Y75N possibly damaging Het
Vmn2r15 T A 5: 109,292,904 N363Y probably damaging Het
Vmn2r60 T A 7: 42,137,052 N426K probably benign Het
Wisp2 T A 2: 163,829,077 M168K unknown Het
Znhit2 C A 19: 6,062,258 N344K probably damaging Het
Other mutations in Atp6v1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01560:Atp6v1b1 APN 6 83749915 splice site probably benign
IGL02005:Atp6v1b1 APN 6 83753914 unclassified probably benign
IGL02085:Atp6v1b1 APN 6 83753915 unclassified probably benign
IGL02100:Atp6v1b1 APN 6 83758444 missense probably damaging 1.00
IGL02267:Atp6v1b1 APN 6 83756909 missense probably benign 0.44
IGL02507:Atp6v1b1 APN 6 83756855 missense possibly damaging 0.95
IGL02563:Atp6v1b1 APN 6 83755451 missense probably benign 0.14
IGL03144:Atp6v1b1 APN 6 83758351 missense probably benign 0.02
R0391:Atp6v1b1 UTSW 6 83756921 missense possibly damaging 0.93
R0420:Atp6v1b1 UTSW 6 83752844 unclassified probably benign
R0458:Atp6v1b1 UTSW 6 83752408 missense probably damaging 1.00
R0561:Atp6v1b1 UTSW 6 83753811 missense probably damaging 1.00
R0947:Atp6v1b1 UTSW 6 83753832 missense probably damaging 1.00
R1417:Atp6v1b1 UTSW 6 83753880 missense probably damaging 1.00
R1447:Atp6v1b1 UTSW 6 83757942 missense possibly damaging 0.46
R1710:Atp6v1b1 UTSW 6 83758390 missense probably benign
R1722:Atp6v1b1 UTSW 6 83743092 missense possibly damaging 0.68
R1862:Atp6v1b1 UTSW 6 83749852 critical splice acceptor site probably null
R2086:Atp6v1b1 UTSW 6 83757852 missense probably benign 0.10
R3433:Atp6v1b1 UTSW 6 83743092 missense possibly damaging 0.81
R4193:Atp6v1b1 UTSW 6 83743103 missense probably benign 0.01
R4606:Atp6v1b1 UTSW 6 83752461 missense probably damaging 1.00
R5901:Atp6v1b1 UTSW 6 83758357 missense possibly damaging 0.87
R6156:Atp6v1b1 UTSW 6 83758133 missense probably damaging 1.00
R6187:Atp6v1b1 UTSW 6 83752395 missense probably damaging 1.00
R6717:Atp6v1b1 UTSW 6 83753650 splice site probably null
R6727:Atp6v1b1 UTSW 6 83751875 unclassified probably benign
R6952:Atp6v1b1 UTSW 6 83754810 missense probably damaging 1.00
R7753:Atp6v1b1 UTSW 6 83752458 missense probably benign 0.02
R7852:Atp6v1b1 UTSW 6 83752470 missense possibly damaging 0.47
R8421:Atp6v1b1 UTSW 6 83753809 missense probably damaging 0.99
R8840:Atp6v1b1 UTSW 6 83756863 missense
Predicted Primers PCR Primer
(F):5'- TGTGAGATTCAAACCACCTCCTCCC -3'
(R):5'- CTGCAAGCAAATGCCTTGTCCTC -3'

Sequencing Primer
(F):5'- GTCTCTCTCGGCCTCACAG -3'
(R):5'- AAATGCCTTGTCCTCAGTGG -3'
Posted On2014-01-29